ID: 1125519318

View in Genome Browser
Species Human (GRCh38)
Location 15:40339373-40339395
Sequence GACTGCAGGAGGTTGGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 490
Summary {0: 1, 1: 0, 2: 0, 3: 42, 4: 447}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125519318 Original CRISPR GACTGCAGGAGGTTGGGAGC TGG Intronic
902507036 1:16945400-16945422 GGCTACAGGAGGTTCGGGGCAGG + Intronic
903446052 1:23423847-23423869 CTCGGCGGGAGGTTGGGAGCAGG - Intronic
903478211 1:23634918-23634940 GACAGCAGGGGGTTGAGAGAAGG + Intronic
903479625 1:23643893-23643915 GACTGGAGCAGGGAGGGAGCTGG - Intergenic
903547982 1:24138713-24138735 AGCTGCAGGAGGGTGGGAGGAGG + Exonic
903804608 1:25996276-25996298 GATTGCTGGGGCTTGGGAGCCGG + Intronic
903941846 1:26937364-26937386 GACTGCTTGAGCCTGGGAGCCGG - Intronic
904031226 1:27534612-27534634 GTGTGCAAGAGGTTGCGAGCGGG - Exonic
905029528 1:34872341-34872363 GACTGCAGCAGGTTGTCAGGAGG + Intronic
905337677 1:37256713-37256735 GAGAGAAGGAGGATGGGAGCAGG - Intergenic
906343655 1:45002149-45002171 GACTGCAACGGGTTGGGGGCAGG + Intergenic
907011584 1:50968550-50968572 GACGGGAGGAGGTGGAGAGCGGG + Exonic
907052023 1:51336025-51336047 GACTGCAGGTGTTGGGGAGGGGG - Intronic
907316370 1:53575274-53575296 GACCGCAGGAGGGTTGAAGCAGG - Intronic
907789536 1:57648429-57648451 TAGTGGAGGAGGTTGGGAGCTGG - Intronic
908741865 1:67337082-67337104 TACTGCAGGAGGAGGGGAGATGG + Intronic
908941116 1:69435486-69435508 GAGTGAAGGTGTTTGGGAGCAGG - Intergenic
908962663 1:69718226-69718248 GACTGCAGGGAGTTTGGTGCTGG + Intronic
910126643 1:83849906-83849928 CACTGCAGGAGCTTGGAATCAGG - Intergenic
911741284 1:101388791-101388813 GAATCCAGGAGGGTGGGAACAGG + Intergenic
912677530 1:111698842-111698864 GAGAGCAGGAGGGTGGGAGAGGG - Intronic
912740275 1:112188306-112188328 GACTACAGGAGGTCTGGAGAAGG + Intergenic
912829743 1:112941872-112941894 GACAGAAGGAGGTTGAGAGGAGG + Intronic
913320899 1:117587720-117587742 GCCAGCAGGATGTGGGGAGCAGG + Intergenic
914918340 1:151831667-151831689 GACTGCTGGAGGTTCAGAGGAGG - Intronic
915345534 1:155195150-155195172 GGCTTCAGGCGGTGGGGAGCGGG + Intergenic
916224439 1:162475420-162475442 TACTGCCTGAGGTTGGGAGAGGG - Intergenic
916263216 1:162862880-162862902 GACTCCAGGAAGTTTGGAGATGG - Intronic
917591340 1:176480138-176480160 GACTGCAGGACATGGGGAGGAGG - Intronic
917826698 1:178829357-178829379 CACAGCAGGAGGTGGGCAGCAGG + Intronic
918069444 1:181124224-181124246 GGCTGCAGGAGGTGGGAAGAAGG + Intergenic
919685364 1:200479204-200479226 GACTCCAGTAGGATGGGAGGTGG - Intergenic
919739571 1:200973726-200973748 GACTGCAGGTGGTGGGGTGCTGG + Intronic
919909299 1:202100931-202100953 GACTGCTTGAGGTGGGGAGGTGG - Intergenic
920039447 1:203085989-203086011 GGCTGCTGGAGCTTGGGGGCTGG - Exonic
920779067 1:208970325-208970347 TACTGCAGTAGCTGGGGAGCAGG + Intergenic
920847097 1:209603341-209603363 GCCTACAGGAGGTTGGTCGCTGG + Intronic
921278673 1:213544240-213544262 TGCTGCAGGAGGTAGGGAGAGGG + Intergenic
921712000 1:218382175-218382197 CACTGCAGGAGGTGGGGAGGGGG - Intronic
921787304 1:219245923-219245945 GACTGCATGAAGTTAGGAGATGG + Intergenic
922273891 1:224058743-224058765 GACTGGAGGAGCCTGTGAGCTGG - Intergenic
922294649 1:224238994-224239016 GACTGCCAGAGGTTGGGAGGCGG - Intronic
923679827 1:236110521-236110543 GACTGCTGGAGGCTTGGATCTGG + Intergenic
924554675 1:245108222-245108244 GACTGCAGGAGGCTGGGAAATGG - Intronic
1062995081 10:1858166-1858188 GACAGCAGGAAGCTGGGAGCTGG - Intergenic
1063684160 10:8220492-8220514 GAGTCCAGGAGTTTGGGATCAGG + Intergenic
1064023240 10:11826038-11826060 GGCTGCCAGAGGTTGGGAGAGGG - Intronic
1064769632 10:18710610-18710632 GGCTGCAGGAAGGTGGGAGGTGG - Intergenic
1064893177 10:20203381-20203403 GAGTGCAGGAGGTTGAGTGTAGG - Intronic
1065758515 10:28958841-28958863 GGCTGCAGAAGGTAGGGAGAAGG + Intergenic
1065970355 10:30801047-30801069 GACTGGAGGAGATGGGGGGCTGG + Intergenic
1066477345 10:35760849-35760871 GACTGCAGGACTTGGGGGGCAGG + Intergenic
1067044323 10:42975798-42975820 GACTCCAAGTGGGTGGGAGCTGG + Intergenic
1067138548 10:43633938-43633960 GCCTATTGGAGGTTGGGAGCAGG - Intergenic
1067877496 10:50018885-50018907 CACTGCAGAGGGTTGGGTGCTGG - Intergenic
1068675168 10:59762981-59763003 GCTTGCAGCAGGTTTGGAGCAGG + Intergenic
1068819662 10:61359623-61359645 CACAGCAGGAGGTTAGCAGCGGG + Intergenic
1069535973 10:69253376-69253398 TTCTGCAGGGGCTTGGGAGCAGG + Intronic
1069714231 10:70510256-70510278 GATTGCTGGAGGTTGGAAGTGGG + Intronic
1069835972 10:71308406-71308428 GAATGCAGGAGGGAGGTAGCTGG - Intergenic
1069863855 10:71488121-71488143 GCCTGCAGGAGAGTGGGAGATGG + Intronic
1069985815 10:72282539-72282561 GATTGCCTGAGGTTGGGAGTTGG + Intergenic
1070523547 10:77275703-77275725 TCCTGCAGGAAGTTGTGAGCAGG + Intronic
1070562584 10:77578993-77579015 GACTCCGGGAGGTTGGCAGCTGG - Intronic
1070691692 10:78531895-78531917 GACAGCAGGAGGTGAGCAGCAGG - Intergenic
1071481089 10:86065474-86065496 GAATGCATGTGGCTGGGAGCTGG - Intronic
1072478385 10:95785621-95785643 GGCTGAAGGAAGTTGGGAGGTGG + Intronic
1072722382 10:97789015-97789037 CTCTGCAGGAGGGTGGGAGCAGG - Intergenic
1073149429 10:101301904-101301926 GCGTGTAGGAGGTAGGGAGCTGG - Intergenic
1073466824 10:103699103-103699125 GACAGCTGGGGGTTGGGGGCAGG + Intronic
1074343546 10:112658038-112658060 GAATGCAGGAAGTTGGGAGGTGG - Intronic
1074546068 10:114403550-114403572 GTCTGCAGGAGGATGGGGGAGGG + Intronic
1075330157 10:121568177-121568199 GACTCTAGGATGTTGGGAGTGGG - Intronic
1076783126 10:132735431-132735453 GAATGCTGGAGGCTGGGGGCAGG + Intronic
1077042714 11:531637-531659 GAGTGGACGAGGTTGGCAGCTGG - Intergenic
1077377741 11:2213149-2213171 GGCTGGAGGAGGTTGGGATGGGG - Intergenic
1077539421 11:3139570-3139592 GCCCGCAGGAGTTTGGGGGCAGG + Intronic
1079034030 11:17007064-17007086 GGCTCCAGGAGGCTGGGAGTGGG - Intronic
1079697220 11:23496465-23496487 GTCTACTGAAGGTTGGGAGCAGG + Intergenic
1081625940 11:44655107-44655129 CACTGGGGGAGGTCGGGAGCAGG - Intergenic
1081671153 11:44943364-44943386 GGCTGCAGGAGGCTGGGGGCAGG + Intronic
1081967219 11:47177187-47177209 GGCTGCGGGAGGCTGGGGGCGGG + Intergenic
1082852522 11:57778039-57778061 CACTTCAGGGGGTTGTGAGCAGG + Intronic
1083541577 11:63515310-63515332 GACTACAGGAGGATGGGGGTGGG - Intronic
1083775461 11:64892505-64892527 GACAGCAGGGGCCTGGGAGCTGG + Intergenic
1084030118 11:66476207-66476229 GGCTGCAGGAGGTGGGGACCTGG - Exonic
1084038737 11:66529674-66529696 GTCTGCAGGAGCTGGGGAGGAGG - Intronic
1084111341 11:67015875-67015897 GATCTCAGGAGGCTGGGAGCAGG + Intronic
1084365196 11:68693112-68693134 GAGTGCAGGAGGCTGGGGGGCGG - Intergenic
1084417413 11:69041063-69041085 GACTCATGGAGGTTGGGGGCTGG + Intergenic
1085253100 11:75156399-75156421 GGCTGCAGGAGCTTGGCAGGGGG + Intronic
1085572189 11:77569178-77569200 CACTGCCTGAGGTTGGGAGAGGG + Intronic
1085942397 11:81220699-81220721 TACAGCTGGAGGTTGGGGGCTGG + Intergenic
1090474621 11:127008628-127008650 GTCTGCCTGAGATTGGGAGCAGG + Intergenic
1090631474 11:128652905-128652927 GACTCTTGGAGGGTGGGAGCTGG - Intergenic
1090988851 11:131798058-131798080 GACTGCCCAAGGTTGGCAGCTGG + Intronic
1091083622 11:132697429-132697451 GACTGGAGGAGGAGGGAAGCAGG - Intronic
1091405534 12:206980-207002 GACTTCAGGAGGCCTGGAGCTGG + Intronic
1092247439 12:6871588-6871610 GACTCCAGAGGCTTGGGAGCTGG + Intronic
1093153175 12:15648100-15648122 CACTGCAGGAGGTGAGCAGCAGG - Intronic
1094019926 12:25903321-25903343 GACTGCAGGAGAATGCGAGCAGG + Intergenic
1094651900 12:32386733-32386755 GACATCAGGAGTTTGGGACCAGG - Intergenic
1095819618 12:46463188-46463210 GACTGAAGAAGGCTGGGACCTGG - Intergenic
1095826060 12:46531301-46531323 CACTGAAGGTGGCTGGGAGCTGG + Intergenic
1096692331 12:53328789-53328811 GGTTGCAAGAGGTGGGGAGCTGG + Exonic
1096841945 12:54385188-54385210 GACTGAGGAAGGTTGGGAGAAGG - Intronic
1098574572 12:72026675-72026697 AAATGCTGGACGTTGGGAGCTGG + Intronic
1101081898 12:101194969-101194991 CACTGCAGGAGGTTGGGAATAGG + Intronic
1101413847 12:104491889-104491911 GGCTGCAGGTGGTAGGGGGCAGG - Intronic
1101725605 12:107385844-107385866 GATGGCAGGAGGGTGGGGGCAGG - Intronic
1102362507 12:112300558-112300580 GACTGAAGGACGTTGGTATCTGG - Intronic
1102415713 12:112760884-112760906 GAATGCAGTGGGTTGGGGGCGGG - Intronic
1103931631 12:124453782-124453804 GACTGGACCAGGCTGGGAGCGGG - Intronic
1103986202 12:124769051-124769073 CACTGCTGGAGGTTGGGGACTGG - Intergenic
1104971461 12:132532711-132532733 CAGTGCAGGAGGGTGGGAGGGGG + Intronic
1105239603 13:18598074-18598096 AGCTGCAGGAGGGTGGGAACCGG - Intergenic
1105519184 13:21116266-21116288 GACTGCAGGGGGATGGGAAGCGG - Intergenic
1106174800 13:27321021-27321043 GAGAGCAGGAGGCTGGGAGAGGG + Intergenic
1106555416 13:30804444-30804466 GACTGAAGGAGGTGGGGAGGAGG + Intergenic
1107130146 13:36886361-36886383 AAATGCAGGAGGATGGGAGATGG + Intronic
1108097447 13:46918664-46918686 GAATCCAGGAGGCTGGGAGGTGG - Intergenic
1108551870 13:51554372-51554394 GACCACAGGAGGTTGGGGACAGG + Intergenic
1108974267 13:56418392-56418414 GAGTGGAGGAGGCTGGGAGGAGG - Intergenic
1109535482 13:63712584-63712606 GATCGCCTGAGGTTGGGAGCTGG - Intergenic
1110767142 13:79293510-79293532 GGATGCAGGAGGTGGAGAGCAGG - Intergenic
1111292798 13:86189068-86189090 CACTGCCGGAGGTTAGGGGCGGG + Intergenic
1112641831 13:101283983-101284005 TGCTGCTGGAGGTTGGCAGCTGG - Exonic
1113059745 13:106309434-106309456 GCCTGCTGGAGGGTGGGGGCTGG + Intergenic
1113677243 13:112215283-112215305 GACTGGAGGAGGGAGGGAGATGG + Intergenic
1113897726 13:113776487-113776509 GACAGCAGCAGGTGGGGATCCGG - Intronic
1114244755 14:20902340-20902362 GACTGCAGAAGGAAGAGAGCAGG - Intergenic
1114547262 14:23512188-23512210 GGGTGCAGGGGGTTGGGGGCTGG + Intergenic
1114550718 14:23531417-23531439 GGCAGCAGGATGTGGGGAGCAGG - Intronic
1117224657 14:53642706-53642728 CACAGCAGGAGGTGGGCAGCAGG - Intergenic
1117493609 14:56277194-56277216 CACAGCAGGAGGTGAGGAGCAGG + Intronic
1118608923 14:67524516-67524538 GACTGCAGGAGGTTCTGGGTGGG - Intronic
1118732924 14:68681900-68681922 GAGTGGAGCAGGTTGGGAGTGGG + Intronic
1119136166 14:72222478-72222500 GACTCCAGGAAGATGGGAACTGG - Intronic
1119293398 14:73514086-73514108 CACTGCAGGAGGATGTGACCTGG - Exonic
1119558992 14:75575232-75575254 GAATGAATCAGGTTGGGAGCCGG - Intergenic
1119768575 14:77206094-77206116 GCCTCCAGGAGGTAGGGGGCGGG - Intronic
1119879066 14:78085950-78085972 AACTGGAAGAGGTTGGGAGCTGG + Intergenic
1120139591 14:80913766-80913788 GAAGGGAGGAGGTTGGGAGCAGG + Intronic
1122112259 14:99510667-99510689 GACGGCAGGAGGTGGGTAGCTGG - Exonic
1122123459 14:99566794-99566816 GCCTGCAGGAGGCAGGCAGCAGG + Intronic
1123491642 15:20786010-20786032 AGCTGCAGGAGGGCGGGAGCCGG + Intergenic
1123548145 15:21355104-21355126 AGCTGCAGGAGGGCGGGAGCCGG + Intergenic
1124661482 15:31553989-31554011 GAGGGCAGGAGAATGGGAGCCGG - Intronic
1125519318 15:40339373-40339395 GACTGCAGGAGGTTGGGAGCTGG + Intronic
1127148205 15:56047678-56047700 GACTACAGGAGCCTGGGACCAGG - Intergenic
1127557450 15:60101407-60101429 GTCTGCAGGAGGTCAGCAGCTGG - Intergenic
1128311135 15:66632305-66632327 GACTGCTGGAGGCTGGGGGTGGG + Intronic
1128386236 15:67150571-67150593 GACTGCAGGAGGCGGGAGGCTGG + Intronic
1128532802 15:68466030-68466052 GACCGCAGGAGTTTGGCACCAGG - Intergenic
1129266833 15:74397697-74397719 GGCAGCATGAGGCTGGGAGCAGG - Intergenic
1129522430 15:76194360-76194382 GACTGCAGAGGGCAGGGAGCTGG - Intronic
1129658801 15:77541805-77541827 GGCGGCAGGAGGAGGGGAGCTGG - Intergenic
1129824958 15:78628886-78628908 AACTGCAGGAAGTGGGAAGCTGG + Intronic
1131266304 15:90917464-90917486 GACTGGAGGAGGGTGACAGCGGG + Intronic
1132278971 15:100596072-100596094 GACTCCAGGAGATTTGGAGTGGG + Intronic
1202956476 15_KI270727v1_random:82334-82356 AGCTGCAGGAGGGCGGGAGCCGG + Intergenic
1132469979 16:97124-97146 TACTGCCTGAGGGTGGGAGCAGG - Intronic
1132558530 16:583271-583293 GACCGCAGCAGGTGGGAAGCGGG - Exonic
1132677381 16:1126413-1126435 GACAGCAGGCGGTGGGGAGAGGG - Intergenic
1133087941 16:3379681-3379703 GGGTGCTGGGGGTTGGGAGCTGG + Intronic
1133685326 16:8160701-8160723 GCCTGTTGGAGGTTGGGAGGGGG + Intergenic
1134764171 16:16742005-16742027 GAGGGCAGGAGGTTGGGAGTGGG + Intergenic
1134981886 16:18617211-18617233 GAGGGCGGGAGGTTGGGAGTGGG - Intergenic
1135500428 16:22991255-22991277 GCCAGGAGGAGGTGGGGAGCTGG + Intergenic
1135560002 16:23468946-23468968 GAATGCAGGAAGCTTGGAGCTGG + Exonic
1136156705 16:28387915-28387937 GACTGCAGGATGCTGGCAACTGG + Intronic
1136206381 16:28727366-28727388 GACTGCAGGATGCTGGCAACTGG - Intronic
1136500265 16:30666563-30666585 GGCTGCATGAGGCTGGGGGCTGG + Intronic
1137667180 16:50258147-50258169 GATTACTTGAGGTTGGGAGCTGG + Intronic
1138349037 16:56336710-56336732 GCCTGTAGGAGGCAGGGAGCTGG - Exonic
1138798004 16:59993376-59993398 GACTCCAGGCTGTTGGGGGCGGG - Intergenic
1140747423 16:77993516-77993538 GACTGCAGATGCTTGGCAGCTGG - Intergenic
1140954445 16:79849225-79849247 GCCTCCAGGAGCTGGGGAGCTGG - Intergenic
1141280897 16:82628560-82628582 GAAGTCAGGAGCTTGGGAGCGGG - Intronic
1141345372 16:83240043-83240065 GGATGCAGGAGGTTGGGTGCAGG + Intronic
1141471683 16:84242919-84242941 GACGCCAGGAGGATGGGAGATGG - Intergenic
1142165582 16:88585774-88585796 GATTGCAGGAGATGGGGAGGGGG + Intronic
1143240296 17:5438172-5438194 GATGTCTGGAGGTTGGGAGCTGG - Exonic
1143594374 17:7905750-7905772 GAGGGCAGGAGGTTGGAAGTTGG + Intronic
1143759344 17:9089831-9089853 AACTGCAGGAGGTCGGTAGCAGG - Intronic
1144438576 17:15262048-15262070 GATGGCAGGAGGCTGGGAACTGG + Intronic
1144945044 17:18965509-18965531 GGCTGAAGGAGGCTGGGAACCGG - Intronic
1146494741 17:33311593-33311615 GACTCTAGGAGTTTGGGAGATGG + Intronic
1148152346 17:45404302-45404324 AGCTGGATGAGGTTGGGAGCTGG - Exonic
1148861731 17:50608091-50608113 GACTGCAGGGGGCTGGGCGCTGG + Intronic
1149157482 17:53648628-53648650 CACTGCAGGGGGTTGGTAGAGGG + Intergenic
1149293478 17:55239083-55239105 GGCTGGAGGGGGTTGGGAGCAGG + Intergenic
1149655886 17:58309379-58309401 GACTGGTGGAGGTGGGGAGGTGG + Exonic
1150210800 17:63440464-63440486 GACAGCATGATGTTGGGAGCTGG - Intronic
1150461633 17:65358627-65358649 GAATGAAGGAGGCTGGGAGTAGG + Intergenic
1150469409 17:65423995-65424017 GACAGCTGGAGATTGCGAGCTGG - Intergenic
1151844157 17:76639763-76639785 GGCTGCTGGAGGTAGGGAGTGGG + Intronic
1152126038 17:78447470-78447492 GGCAGCAGGTGGCTGGGAGCAGG + Intronic
1152250882 17:79212051-79212073 GACTCCAGGAGGGAGGGTGCTGG - Intronic
1152367841 17:79867016-79867038 GACTTCAGGATCTTGGGAACAGG - Intergenic
1152585213 17:81186232-81186254 GAGTGCGGGAGGCTGGGAGTGGG - Intergenic
1152643881 17:81460092-81460114 CACTGCAGGAGGTGGAGAGGAGG + Intronic
1153906173 18:9663361-9663383 GGCTGCAGTAAGGTGGGAGCTGG + Intergenic
1153980279 18:10302878-10302900 GACTGGAGGGGGCTGGGAGAAGG - Intergenic
1156959013 18:43000713-43000735 GGCTGCAGGGGGGTGGGAGTGGG - Intronic
1157305627 18:46515139-46515161 GACTGCAGGAGCGTTGCAGCAGG + Intronic
1157745311 18:50129955-50129977 GACTGCAGGAGGTGGGGCGGTGG - Intronic
1158128593 18:54128301-54128323 GACTGGATGGGGTTGGCAGCTGG - Intergenic
1158243647 18:55406102-55406124 GCCAGCAGGAGGCTGGGAGGTGG + Intronic
1160001707 18:75030795-75030817 GACAGCAGCAGGGTGGGGGCTGG - Intronic
1160167829 18:76529586-76529608 GAGTGCAGGAAGGTGGCAGCGGG - Intergenic
1160433071 18:78825532-78825554 CAGGGCAGGAGGTGGGGAGCAGG + Intergenic
1160557601 18:79736244-79736266 GAGTGCAGCAGGGTGGGGGCTGG - Intronic
1161139069 19:2637270-2637292 GCCTGCAGAAGGATAGGAGCAGG + Intronic
1161185969 19:2921053-2921075 GAATGCAGGAGGCTGGGGGAGGG - Intergenic
1161997452 19:7722363-7722385 CACAGCAGGAGGTTAGCAGCAGG - Intergenic
1162013704 19:7832283-7832305 GACTGCAGGGGGCGAGGAGCCGG + Intronic
1162403112 19:10457858-10457880 GTCTGCAGAAGATGGGGAGCAGG - Exonic
1163207205 19:15812475-15812497 GACTGCAGGAGGAAGGAAGGAGG + Intergenic
1163554602 19:17984895-17984917 GACTGGAGGAGGTGGGAGGCTGG - Intronic
1163636753 19:18440596-18440618 GGGTGCCGGAGGATGGGAGCTGG + Intergenic
1164428789 19:28168763-28168785 GACAGCAGGAGGTCTGGAGGAGG - Intergenic
1164614091 19:29655787-29655809 GCCTGGAGGAAGTTGGGCGCTGG + Intergenic
1164953473 19:32359947-32359969 GACTGCCGGAGGCCAGGAGCTGG - Intronic
1165553206 19:36605705-36605727 AAATGCAGCAGGTTGGGCGCAGG - Intronic
1165667989 19:37650316-37650338 GAGTCCAGGAGTTTGAGAGCAGG - Intronic
1165752068 19:38266217-38266239 GACTGGAGGAGGATGGGAGGTGG + Intronic
1165833082 19:38738707-38738729 GGTGGCAGGAGGTTGGGGGCAGG - Intronic
1165885704 19:39076705-39076727 GACTGCAGGGGGTGAGGAGGGGG + Intergenic
1165982326 19:39735186-39735208 GACTGAGGTAGGGTGGGAGCAGG - Intronic
1166855507 19:45781016-45781038 GGCTGTGGGAGGTTGGGAGAAGG + Intronic
1167504374 19:49863313-49863335 AACAGCAGGAGGGAGGGAGCTGG - Intronic
1167714595 19:51134054-51134076 GACTGCCTCAGGTTGGGAGTGGG + Intronic
1168404818 19:56105201-56105223 GCCTGCAGGAGGGTGGGAGAAGG - Intronic
925215013 2:2086907-2086929 GCCTGCATGAGGTTGGCAGGGGG - Intronic
926731902 2:16041878-16041900 GGCTGGAGGAGGGTGGGAGAGGG + Intergenic
927826902 2:26315599-26315621 GGCTGCAGGAGGATGGGACTGGG + Exonic
928409922 2:31047168-31047190 GACAGCAGGTGGTTGAGAACAGG + Intronic
928641450 2:33303790-33303812 CACTGCAGGAGGTGAGCAGCAGG - Intronic
928801501 2:35099473-35099495 GCCTGTAGGAGGGTGGGAGGTGG - Intergenic
928910919 2:36420087-36420109 GAGGGCAGGAAGTTGGGAGGGGG - Intronic
929457919 2:42079009-42079031 GACTGGAGCATTTTGGGAGCAGG + Intergenic
930055712 2:47250605-47250627 GGCTGCAGGAGGATGGGAACGGG + Intergenic
930306941 2:49686462-49686484 CACAGCAGGAGGTGAGGAGCAGG - Intergenic
930372120 2:50515035-50515057 CACAGCAGGAGGTGGGCAGCAGG + Intronic
931278359 2:60764501-60764523 GACTGCTGGAGCCTGGGAGGCGG - Intronic
933358395 2:81244598-81244620 GCCTGCAGGTGGATTGGAGCAGG - Intergenic
934211377 2:89982174-89982196 AACTGCAGGAGGTGAGCAGCAGG - Intergenic
934666930 2:96178380-96178402 GACAGCAGGAGCCTGGGACCAGG + Intergenic
934758895 2:96842638-96842660 GACTGCAGGAGCTTTGAGGCCGG - Intronic
934921205 2:98346762-98346784 GACTGGAGGGGTATGGGAGCCGG - Intronic
935236152 2:101139740-101139762 GTGTGCAGGAGGGTGGTAGCTGG - Intronic
935697891 2:105785780-105785802 GTCAGCAGGAGGTTGGGCGCAGG + Intronic
935717621 2:105952947-105952969 GAAGGCAGGAGGAAGGGAGCTGG - Intergenic
936642498 2:114330578-114330600 GGCTGAAGGAGGATGGGTGCAGG + Intergenic
936701032 2:115011969-115011991 GACTGCAGGCTGCTGGGAGCAGG + Intronic
936980844 2:118263859-118263881 GAATGCAGGAAAATGGGAGCAGG - Intergenic
937060719 2:118978518-118978540 GACTGCAGGAGGCTGAGAGGCGG - Intronic
937356161 2:121199409-121199431 GACTGGTGGAGGTGGGGGGCAGG + Intergenic
937417552 2:121728789-121728811 GAATTCAGGAGGGTGGAAGCAGG + Intronic
937718283 2:125060456-125060478 AGCTACAGGAAGTTGGGAGCTGG - Intergenic
938339760 2:130527599-130527621 GCCTGCAGAAGGCAGGGAGCAGG + Intronic
938350076 2:130593151-130593173 GCCTGCAGAAGGCAGGGAGCAGG - Intronic
938478324 2:131635812-131635834 GACTGCGTGAGGTTGGTGGCTGG - Intergenic
941116010 2:161472913-161472935 CACAGCAGGAGGTTAGCAGCAGG - Intronic
941802331 2:169673712-169673734 GACTGCCAGAGGCTGGGAACAGG + Intronic
942123938 2:172804687-172804709 CACTGGAGGAGCTTGTGAGCAGG - Intronic
943960194 2:194254353-194254375 GATGGCAGGATGATGGGAGCAGG + Intergenic
944436486 2:199695778-199695800 GAGTGCAGAAGGTTTGGTGCAGG + Intergenic
946155170 2:217802320-217802342 GTCTGCAGAAGGTGGAGAGCAGG - Exonic
946188262 2:217994007-217994029 GACTGCGGAGGGTGGGGAGCTGG + Intronic
946459873 2:219859260-219859282 GAAAGCAGGAGGATGGGAGTGGG + Intergenic
946693362 2:222327020-222327042 GACTGTAGGAGGTGAGGAGATGG + Intergenic
947723292 2:232381839-232381861 GACGACAGGAGGTGGGGAGCAGG - Exonic
947727638 2:232409916-232409938 GACGACTGGAGGTGGGGAGCAGG - Exonic
947736746 2:232459167-232459189 GACGCCCGGAGGTGGGGAGCAGG - Exonic
947850237 2:233281723-233281745 GAGTGCAGGAGCTTGGGTGGAGG + Intronic
947857405 2:233333450-233333472 GGCTGGAGGAGCCTGGGAGCTGG + Intronic
948787683 2:240361427-240361449 GAATGGAGAAGGGTGGGAGCAGG + Intergenic
1169156211 20:3331967-3331989 GAAAGCAGGAGGTAGGGACCAGG - Intronic
1170075829 20:12417728-12417750 GACAGCAGGGGCTGGGGAGCAGG - Intergenic
1170268590 20:14498863-14498885 CACTGCAGGATGTTGAGCGCTGG - Intronic
1170434935 20:16316594-16316616 GAATGAAGAAGGTGGGGAGCAGG + Intronic
1170827074 20:19805866-19805888 GCCTGTTGGAGGTTGGGGGCTGG - Intergenic
1170981603 20:21219537-21219559 GACTGCTTGAGGTCGGGAGTTGG - Intronic
1171146399 20:22787533-22787555 CACTGCTGGAGGCAGGGAGCAGG - Intergenic
1171219763 20:23384533-23384555 GACTGCTTGAGGTTGGGAGGTGG + Intronic
1171339826 20:24419279-24419301 GTCAGCAGGAGGGTGGCAGCAGG + Intergenic
1171782915 20:29437447-29437469 GACTGCTGTAGGTAGGGACCAGG + Intergenic
1172834981 20:37867656-37867678 GACTGCAGGATGAGGGGAGAGGG - Intronic
1173329003 20:42058763-42058785 AACTGCAGGAGGCTGGAAACTGG + Intergenic
1173869004 20:46330273-46330295 GTCTGCAGGTGGTGGGGAGCAGG - Intergenic
1173949536 20:46979243-46979265 GACAGCTGGAGGGTGGGGGCAGG - Intronic
1174128727 20:48327068-48327090 GACCGCGGGAGCTTGGGAGGAGG + Intergenic
1174173754 20:48632413-48632435 GCGGGCAGGCGGTTGGGAGCCGG + Intronic
1174339298 20:49886107-49886129 CACTGCAGGTGGTGGGGAGGGGG - Intronic
1175052299 20:56166889-56166911 GACTGGAGGAGGTGGGGGGATGG - Intergenic
1175230620 20:57471249-57471271 AACTGCAGTGGGTTGGGAGCCGG + Intergenic
1175570172 20:60012241-60012263 ATCTGCAAGAGGGTGGGAGCAGG + Intronic
1175635072 20:60575146-60575168 ATCTCCAGGAGTTTGGGAGCTGG - Intergenic
1175705305 20:61172321-61172343 GGCTCGAGGAGGCTGGGAGCTGG - Intergenic
1178042785 21:28658540-28658562 GCCTGCAGGAGGTTGTAATCTGG + Intergenic
1178810399 21:35876493-35876515 GGCTGTTGGAGGTTTGGAGCAGG + Intronic
1179401637 21:41089881-41089903 GGCAGCAGGAGGTGTGGAGCTGG - Intergenic
1180051665 21:45334451-45334473 GACAGCAGGAGGTGGGGACTTGG - Intergenic
1180169352 21:46049940-46049962 GACCACAGCAGGATGGGAGCTGG - Intergenic
1180619901 22:17154081-17154103 GATTGCCTGAGGTTGGGAGTTGG - Intronic
1180729797 22:17972897-17972919 GGCTGCAGGCGCTTGGGGGCTGG - Intronic
1181690367 22:24555663-24555685 GACAGCAGGAGGTTGGGCCAAGG - Exonic
1182087249 22:27569612-27569634 GTCCACAGGAGGGTGGGAGCAGG + Intergenic
1182320459 22:29475664-29475686 GACTGCACCAGGTGGGAAGCTGG - Intergenic
1183350213 22:37330736-37330758 GACTGCCAGGGGTTGGGGGCGGG + Intergenic
1183368161 22:37417981-37418003 GACAGCAGGAGGGAGGGAGGAGG + Intronic
1184170914 22:42759260-42759282 GAAGGCAGGAGGCGGGGAGCGGG + Intergenic
1184291941 22:43502067-43502089 GGCTCCAGGAGGCTGGCAGCGGG + Intronic
1184559864 22:45256016-45256038 GCCTGCAGGAGGATGAGATCTGG - Intergenic
1184762326 22:46551573-46551595 GCCTGCAGCAGCATGGGAGCAGG - Intergenic
950148546 3:10668726-10668748 GAATGCAGGAGGTTGTTAGATGG - Intronic
950398861 3:12754827-12754849 GACTCCAGGACATGGGGAGCAGG + Intronic
953280197 3:41547676-41547698 GAATGCAGTATGGTGGGAGCTGG - Intronic
953382151 3:42480129-42480151 GAGTGTAGGAGCATGGGAGCTGG + Intergenic
953545860 3:43863238-43863260 CACTGCAGGAGCTCTGGAGCAGG + Intergenic
960047381 3:113211456-113211478 GAGTGGAGGAGGCTGGGAGGAGG - Intronic
960439508 3:117669589-117669611 GACTGCAGGAGATCTGGAGGGGG + Intergenic
960951431 3:123000987-123001009 GACTGCACTAGATGGGGAGCCGG + Intronic
961769549 3:129238966-129238988 GACACCAGGAGTTTGAGAGCAGG - Intergenic
962939897 3:140116370-140116392 GCCTGCAGGAGGCTCTGAGCAGG + Intronic
963290093 3:143478455-143478477 GTCAGCAGGAGGCTGGGAGGTGG + Intronic
963450970 3:145481579-145481601 GACTGCCTCAGGTTGGGAGTGGG + Intergenic
963501062 3:146127321-146127343 AAAAGCAGGAGGTTGGGAGAGGG - Intronic
966917485 3:184593083-184593105 GAGTGGAGGAGGTTGGGCCCTGG + Intronic
967056073 3:185829474-185829496 CACAGCAGGAGGTGAGGAGCAGG - Intergenic
967977933 3:195045769-195045791 GACCCCAGGAGGTCAGGAGCTGG - Intergenic
968090065 3:195893929-195893951 AACTCCAGGAGGTGGGGAGAAGG + Intronic
968809593 4:2793825-2793847 GACTGGAGGAGTTAGGGGGCGGG + Intronic
968812835 4:2807844-2807866 GTGTGCAGGAGGGTGGGAGGTGG + Intronic
969207127 4:5655457-5655479 GACTGCAGGAGGCTGGACACAGG - Intronic
969216148 4:5723926-5723948 GAATGCAGGGGATTGAGAGCAGG + Intronic
969446473 4:7247675-7247697 GAGTGCTGGAGGTGGGCAGCGGG + Intronic
969496166 4:7527487-7527509 GACTGCAGGAGGTCGCTAGCAGG + Intronic
969566146 4:7979364-7979386 GCCTGCGGGAGGGTGGGAGATGG - Intronic
970451397 4:16169668-16169690 TACTGCAGGAGCTGGGAAGCAGG + Intronic
972213194 4:36863246-36863268 GACGGGGAGAGGTTGGGAGCAGG + Intergenic
974020272 4:56686917-56686939 GAAAGCAGGGGGTGGGGAGCTGG + Intergenic
974082840 4:57230691-57230713 AACAGCAGGAGGTGGGCAGCTGG + Intergenic
974178981 4:58360544-58360566 GACTGCAGGTTGATGGGGGCAGG - Intergenic
978403921 4:108360288-108360310 GACGGAAGGAGGTTGGGAGAAGG + Intergenic
978795665 4:112705667-112705689 GACTGCCGGAGTTCGGGAGGTGG - Intergenic
979636611 4:122962183-122962205 CACAGCAGGAGGTGGGCAGCAGG - Intronic
980798160 4:137711912-137711934 GACTGTAGGAGTTTGTGGGCAGG + Intergenic
981784500 4:148462169-148462191 CACAGCAGGAGGTAGGCAGCGGG + Intergenic
983741813 4:171143777-171143799 GCCTGAAGGAGGTGGGGAGGTGG - Intergenic
983755197 4:171326695-171326717 GATTGCCTGAGGTTGGGAGTTGG - Intergenic
985096376 4:186416757-186416779 GACAGCAGGAGGATGGGAAATGG + Intergenic
985524457 5:394980-395002 GACAGCAGGAGGCTGGGGCCGGG - Intronic
985790808 5:1926123-1926145 GGCTGCAGGTGGTTGAGAGTGGG - Intergenic
985972421 5:3388879-3388901 GACTGAAGGAAGGTGGGACCTGG - Intergenic
986232013 5:5874197-5874219 AGCTGCAGGAGGTAGGGAGATGG - Intergenic
986387265 5:7247088-7247110 GACTGCTTGAGGCTGGGAGTTGG - Intergenic
987187398 5:15438619-15438641 AAGGGTAGGAGGTTGGGAGCAGG + Intergenic
987373899 5:17217426-17217448 GAGTGCAGGGGGTGGGGAGATGG + Intronic
987620319 5:20331723-20331745 GACTTCAGGAAGTTGGGCCCAGG - Intronic
988714027 5:33806912-33806934 GACTGCAGGAGTTAGAGTGCGGG - Intronic
988721723 5:33885750-33885772 GACTGCTGGAGATGGGGAGGGGG + Intronic
990013551 5:51029409-51029431 CAGCGCAGGAGGTTGGGAGAGGG - Intergenic
990247117 5:53874194-53874216 CACAGCAGGAGGTGGGCAGCAGG - Intergenic
991281477 5:64919506-64919528 GACTGCTGGAGGTGGGGAGTAGG - Intronic
991647756 5:68818449-68818471 GACTGCGGGAGGGAGGCAGCAGG + Intergenic
992517242 5:77506879-77506901 GCCTGTAGGGGGTGGGGAGCTGG + Intronic
993745835 5:91595986-91596008 GCCTGCAGAAGGTTGGGGGAGGG - Intergenic
996713733 5:126569056-126569078 CACAGCAGGAGGTAGGCAGCAGG + Intronic
996771320 5:127088815-127088837 GACGCCAGCAGGCTGGGAGCTGG + Intergenic
997228539 5:132227415-132227437 GGCTGCCGGCTGTTGGGAGCGGG - Intronic
997658834 5:135574965-135574987 CACTGCATGAGGTTGGGGGTGGG - Intronic
997979667 5:138460983-138461005 GATTCCAGGAGGCTGGGAGACGG - Intergenic
998038775 5:138937721-138937743 GAGTGCAGGGAGTAGGGAGCAGG - Intergenic
999106436 5:149075236-149075258 GGCTCTAGGAGGTGGGGAGCAGG - Intergenic
1001024375 5:168211185-168211207 AACTGCAGTAGGCTGTGAGCAGG + Intronic
1001658015 5:173368829-173368851 GATGGGAGGAGGTTGGCAGCTGG + Intergenic
1002270466 5:178068476-178068498 GACAGCTGGTGGGTGGGAGCCGG + Intergenic
1002300327 5:178254178-178254200 GAGTGCAGGGAGTTGGGAGATGG - Intronic
1002480291 5:179496544-179496566 GAATGCAGGTTGGTGGGAGCTGG - Intergenic
1003276986 6:4661546-4661568 GCCTGCATGTGGCTGGGAGCTGG - Intergenic
1003534797 6:6967312-6967334 AACTCCATGAGGGTGGGAGCTGG + Intergenic
1004500528 6:16206036-16206058 GATTGCTGGAGGGTGGGAGGTGG - Intergenic
1004515343 6:16317714-16317736 GAGTGGAGGAGGGTGGGAGGCGG - Intronic
1005390789 6:25331167-25331189 GACAGCAGGAGGCTGGAAGGAGG - Intronic
1005897624 6:30191547-30191569 GAGTGAAGGGGGATGGGAGCAGG + Intronic
1006188169 6:32192045-32192067 GTCTGGAGGAGGTGGGGAGAGGG + Intronic
1006523436 6:34585364-34585386 GCCTGCAGGAAGATGGGAGAGGG - Intergenic
1007098265 6:39227920-39227942 GATTGCAGCAGGTAGGGAGTAGG - Intronic
1007358769 6:41341000-41341022 GAGTCCAGGAGGTGGGGAGAAGG - Intronic
1007821511 6:44563754-44563776 GAATGCAGGAGGGCGTGAGCTGG - Intergenic
1012319074 6:97820073-97820095 GATTGCAGGAGGATGGGGGAAGG - Intergenic
1013496199 6:110699951-110699973 CACAGCAGGAGGTGGGCAGCAGG + Intronic
1014597141 6:123359219-123359241 GACTGTAGGAAGATTGGAGCAGG - Intronic
1015366837 6:132405056-132405078 GACTGCAAGGGGTTGGGGGAAGG + Intergenic
1015517964 6:134103012-134103034 GACTGCAGGCTGTTGGCAGGGGG + Intergenic
1017012615 6:150072592-150072614 GACTGCAGGGGGTCAGGAGAGGG + Intergenic
1017726678 6:157281131-157281153 GAGTGCAGGAGGGTGAGAGCTGG - Intergenic
1019061827 6:169262766-169262788 GAGTGCAGGAGGTACGGAGGGGG - Intergenic
1019154477 6:170029917-170029939 GGCTGCAGGACCTTGGGTGCAGG - Intergenic
1019154514 6:170030089-170030111 GACTGCAGGACCTCGGGTGCAGG - Intergenic
1019154527 6:170030167-170030189 GACTGCAGGACCTCGGGTGCAGG - Intergenic
1019516383 7:1442029-1442051 GACCCCAGGAGGCTGCGAGCAGG + Intronic
1019599266 7:1873346-1873368 TACAGCAAGAGGGTGGGAGCAGG + Intronic
1020033900 7:4952172-4952194 GACTGCAAGCCGCTGGGAGCAGG - Intronic
1021346814 7:19539266-19539288 GGCTGCTGGAGGTGGGGATCTGG + Intergenic
1022230355 7:28408167-28408189 GACACCAGAAGGTTGGGGGCTGG - Intronic
1022457127 7:30567202-30567224 GACAGTAGGAGGTTGGCAGATGG - Intergenic
1022620953 7:31984167-31984189 GACAGCAGGAGGTGAGCAGCTGG + Intronic
1023435668 7:40138109-40138131 GACTACAGGAGGTTGCTTGCTGG - Intronic
1024009994 7:45259286-45259308 GAGGGCAGGATGTGGGGAGCAGG - Intergenic
1024213781 7:47228956-47228978 GACTGGAGGAGGATGGAGGCAGG - Intergenic
1024967366 7:55035864-55035886 TACTGGAGGAGGTTGGGGGAAGG - Intronic
1026483583 7:70798962-70798984 GAATGTAGGAGGTTGGGTGGGGG - Intergenic
1027225755 7:76242899-76242921 CACAGCAGGAGGTGAGGAGCAGG - Intronic
1029105331 7:98170555-98170577 GACGGCTGGAGGCGGGGAGCGGG - Intronic
1031114255 7:117650578-117650600 GACTGCGGGAGGATGGTAGGGGG - Intronic
1031984811 7:128157232-128157254 GGTTACAGGTGGTTGGGAGCTGG - Intergenic
1032078691 7:128848171-128848193 GACTGGACGAGGCTGAGAGCTGG - Intronic
1032217553 7:129969363-129969385 GAGTACTGGAGGTTGGGAGAAGG - Intergenic
1032532940 7:132636905-132636927 GGATGCAGGAGGTGGGGAGGTGG + Intronic
1034063765 7:148117428-148117450 GCCTGGAGGAGGTGAGGAGCCGG - Intronic
1034342384 7:150366304-150366326 GCCTGCAGGAAGTGGGGAGGGGG - Intergenic
1034546466 7:151792923-151792945 GCCTGCAGCAGGGAGGGAGCCGG + Intronic
1035196539 7:157226073-157226095 GACAACAGGAGGTGGGGAACTGG - Intronic
1035202682 7:157277290-157277312 GGCTGCAGGAGGTGGGGGGTGGG - Intergenic
1035486000 7:159226606-159226628 GCCTGCAGGAGATTCGGAGCAGG + Intergenic
1035718621 8:1773387-1773409 GGCAGGAGGAGGTTGGGGGCCGG + Intronic
1036174356 8:6522558-6522580 GAGTCCAGGAGCTTGAGAGCAGG + Intronic
1036919899 8:12842350-12842372 GAGAGGAGGAGGTTGAGAGCTGG - Intergenic
1037742491 8:21618581-21618603 CACAGCAGGAGGTGGGCAGCAGG + Intergenic
1037756937 8:21716481-21716503 GACTGCAGGAGTGTTGGAGTAGG + Intronic
1038678559 8:29645590-29645612 GACTGCTGGAGGTTCTGAGCTGG + Intergenic
1039829395 8:41200925-41200947 GAGTGGAGCAGGGTGGGAGCTGG + Intergenic
1040949175 8:52918901-52918923 GACTGCAGAAGCTTCTGAGCAGG + Intergenic
1041381555 8:57258619-57258641 AACTGCAGGAGGGCGGGAACCGG + Intergenic
1041745619 8:61206338-61206360 GTGTGCAGTAGGTTTGGAGCAGG + Intronic
1042515388 8:69653741-69653763 GACAGCTCTAGGTTGGGAGCTGG - Intronic
1043941801 8:86204634-86204656 GACTGCTGGCTGCTGGGAGCTGG - Intergenic
1044705076 8:95000712-95000734 GACTGCTGGAGGTCAGGAGCTGG + Intronic
1044895589 8:96888148-96888170 GACTGCAGGAGGTGTGGTGTGGG - Intronic
1045105006 8:98883918-98883940 GACTTCAGCATGTTGGGAACAGG + Intronic
1046687655 8:117245012-117245034 CACTGCAGGAGAATGGGAGGAGG + Intergenic
1047301617 8:123618326-123618348 CACAGCAGGAGGTGGGGGGCAGG + Intergenic
1047895643 8:129363496-129363518 GACTACTAGAGGGTGGGAGCGGG + Intergenic
1048439664 8:134450635-134450657 GACTGCAGGTGAGTGGGTGCAGG - Intergenic
1049659438 8:143813188-143813210 GAGGGCAGGCGGGTGGGAGCTGG - Intronic
1050642408 9:7682394-7682416 GAATGAAGGGGGTTGGGAGGAGG - Intergenic
1051145516 9:14023245-14023267 GACTTCAGGAGTTTGAGACCAGG - Intergenic
1051604463 9:18906671-18906693 GCCTGCAGGAGGATGGTGGCAGG - Exonic
1055131375 9:72778896-72778918 GGCTGCAGGTGGTTGTGTGCGGG - Intronic
1055486863 9:76764698-76764720 GACAGCAGAAGGGTAGGAGCAGG + Intronic
1055670163 9:78596648-78596670 GACTGCAGTAGGTTGAGAAGTGG - Intergenic
1057610313 9:96537074-96537096 GAGTGCAGGAGTTTGTGACCAGG + Intronic
1058414161 9:104767897-104767919 GGTTGCAGGAGGTTGGTACCAGG + Intronic
1059723720 9:116986161-116986183 GACTGCAGGGGGGTGGGGGGGGG - Intronic
1060186012 9:121564633-121564655 GGCAGCGGGAGGTTGGGAGCTGG + Intergenic
1060234625 9:121853613-121853635 GACTGCAGGCAGCTGGGGGCCGG + Intronic
1061000342 9:127899195-127899217 GAGTGCAGGAGTTGGGGAGGGGG - Intronic
1061117913 9:128626314-128626336 CAGTGCAGGAGGTGGGGTGCGGG - Intronic
1061238066 9:129353404-129353426 GACTGCAGCAGGATTAGAGCTGG - Intergenic
1061409449 9:130411134-130411156 GCATGCTGGAGGCTGGGAGCCGG - Intronic
1061924899 9:133801177-133801199 GGATGCAGGAGGTTGGGGGTGGG + Intronic
1062371500 9:136241534-136241556 GACAGGTGGGGGTTGGGAGCTGG - Intronic
1062504406 9:136865891-136865913 GACTGGAGGAGGAGAGGAGCAGG - Intronic
1189642126 X:43084614-43084636 CACAGCAGGAGGTTAGCAGCTGG - Intergenic
1190261021 X:48796879-48796901 CACAGCAGGAGGTGGGCAGCAGG + Intergenic
1191677178 X:63803742-63803764 GCCTGCTGGGGGTTGGGGGCTGG + Intergenic
1192466125 X:71357402-71357424 CACTGCAGGGGGTGGGGACCAGG - Intergenic
1192547611 X:72026948-72026970 GACTTCAGCAACTTGGGAGCTGG + Intergenic
1192679830 X:73241173-73241195 CACTGCTGGAGGATGGGAGAGGG - Intergenic
1194085588 X:89523891-89523913 GGCAGCAAGAGGGTGGGAGCAGG - Intergenic
1194141738 X:90217613-90217635 AACTGCCAGAGGTTGGGAGTGGG + Intergenic
1194783959 X:98058681-98058703 CACTGCTGGAGGATGGGAGAGGG + Intergenic
1196736022 X:118981718-118981740 GTCTTCAAGAGGTTTGGAGCAGG + Intronic
1198033879 X:132782004-132782026 TTCTGCAGAAGGTTGTGAGCAGG + Intronic
1198121925 X:133602352-133602374 TACTGCAGGAGGTGAGTAGCAGG + Intronic
1198322459 X:135532019-135532041 GAAGGAAGGAGGGTGGGAGCTGG + Intronic
1198410826 X:136365946-136365968 GTCTGCAGGTGGTTGGGGGAGGG - Intronic
1198572901 X:137976954-137976976 GCCTGCTGGGGGTCGGGAGCTGG + Intergenic
1200076902 X:153555627-153555649 GCCTGCAAGGGGTTGAGAGCGGG - Intronic
1200183047 X:154162972-154162994 GACTGTAGGAGGTGGAGAGAGGG - Intergenic
1200188701 X:154200086-154200108 GACTGTAGGAGGTGGAGAGAGGG - Intergenic
1200194350 X:154237227-154237249 GACTGTAGGAGGTGGAGAGAGGG - Intergenic
1200200106 X:154275030-154275052 GACTGTAGGAGGTGGAGAGAGGG - Intronic
1200487489 Y:3786714-3786736 AACTGCCAGAGGTTGGGAGTGGG + Intergenic
1201770769 Y:17615031-17615053 GACTGCACGAGGTGGGACGCAGG + Intergenic
1201830786 Y:18290955-18290977 GACTGCACGAGGTGGGACGCAGG - Intergenic