ID: 1125525358

View in Genome Browser
Species Human (GRCh38)
Location 15:40370696-40370718
Sequence CCTGACAAGATCCCTAGGAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 88}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125525358_1125525368 25 Left 1125525358 15:40370696-40370718 CCCATCCTAGGGATCTTGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1125525368 15:40370744-40370766 CAGCAATCTCCACAGCCTCCTGG 0: 1
1: 0
2: 2
3: 44
4: 411
1125525358_1125525369 26 Left 1125525358 15:40370696-40370718 CCCATCCTAGGGATCTTGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1125525369 15:40370745-40370767 AGCAATCTCCACAGCCTCCTGGG 0: 1
1: 0
2: 0
3: 36
4: 339
1125525358_1125525363 -4 Left 1125525358 15:40370696-40370718 CCCATCCTAGGGATCTTGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1125525363 15:40370715-40370737 CAGGGTTCCTTACTGACCAGAGG 0: 1
1: 0
2: 0
3: 14
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125525358 Original CRISPR CCTGACAAGATCCCTAGGAT GGG (reversed) Exonic
901893020 1:12284327-12284349 CCTTACAACAACCCTATGATGGG - Intronic
913329227 1:117653446-117653468 CCTCACAACAGCCCTAGGAGGGG - Intergenic
919246700 1:194996652-194996674 CTTGACATAATCCCTTGGATGGG - Intergenic
1064532348 10:16323181-16323203 CCTGACAAGAGCCATAGCCTTGG + Intergenic
1064874461 10:19977350-19977372 TTTCACAAGATCCCCAGGATAGG + Intronic
1067384391 10:45805436-45805458 CTTGGGTAGATCCCTAGGATTGG + Intergenic
1070130033 10:73649315-73649337 CCTAACATGGTCCCTATGATGGG - Intronic
1072720412 10:97777520-97777542 CCTGACAAGGCCCCCAGGAGAGG + Intergenic
1074721353 10:116268046-116268068 TTTAACAAGATCCCTAGGCTGGG - Intronic
1075095373 10:119467718-119467740 CCTGACAAGTCCCCCAGGAGAGG - Intergenic
1075790449 10:125080484-125080506 CCTGACAACACCCCTAGCATGGG + Intronic
1079123407 11:17700884-17700906 CCTTACAACATCCCTTGGAGTGG + Intergenic
1084030749 11:66479483-66479505 ACTTACAATATCCCTTGGATTGG + Intergenic
1090398972 11:126436260-126436282 CTTGTCCAGATCCCTAGGGTCGG - Intronic
1090409359 11:126496986-126497008 CCTGACAGGATTCCCAGGCTGGG - Intronic
1090580454 11:128153326-128153348 CCTCACAAGAACCCTAAGGTAGG + Intergenic
1091077276 11:132632095-132632117 CCTGTAAACATCCCTAGGATAGG + Intronic
1091168760 11:133502417-133502439 GCTGACAAGCTCCCTGGGAAAGG + Intronic
1097430764 12:59503159-59503181 TCTTACAGGATCCCTAGGTTTGG + Intergenic
1099498287 12:83379202-83379224 CCTCACAAGTTCCCCAGGCTTGG - Intergenic
1100179428 12:92069293-92069315 CCTCACAACAACCCTACGATGGG + Intronic
1103230289 12:119324595-119324617 CCTCACAAGAATCCCAGGATAGG + Intergenic
1110732118 13:78890760-78890782 CTTGAATAGATACCTAGGATTGG - Intergenic
1112297808 13:98203746-98203768 CCTGGGAAGATACCTAGGAGTGG + Intronic
1118989842 14:70787894-70787916 CCTCACATCATCCCTAGTATAGG - Intronic
1119348330 14:73944264-73944286 CCTGACTAAATCCCTATGGTGGG + Intronic
1119692544 14:76687794-76687816 CCTGATAAGATCTCCAGAATTGG + Intergenic
1119748110 14:77058869-77058891 CCTGACAGCTTCCCGAGGATAGG - Intergenic
1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG + Intronic
1122806908 14:104264486-104264508 CCTGAGAAGATCCAGAGGAAGGG - Intergenic
1124647982 15:31453400-31453422 CCTGACAAGAGCCTTAGCCTTGG - Intergenic
1125525358 15:40370696-40370718 CCTGACAAGATCCCTAGGATGGG - Exonic
1132113917 15:99121862-99121884 CCAGACCAGAAACCTAGGATGGG - Intronic
1132372820 15:101309889-101309911 CCTGATAAGTTCCCTAAGAGAGG - Intronic
1137489362 16:48918767-48918789 CTTGCCCATATCCCTAGGATGGG + Intergenic
1140672033 16:77288810-77288832 GCAAACAAGATCACTAGGATAGG + Intronic
1142128294 16:88420969-88420991 CTGGAGAAGATCCCTCGGATTGG - Intergenic
1143302453 17:5920986-5921008 CCTGAGAACATACCTAGGAGTGG - Intronic
1144742754 17:17593158-17593180 CTTCACAACATCGCTAGGATGGG + Intergenic
1147882569 17:43663432-43663454 CCTCACAACTTTCCTAGGATGGG + Intergenic
1155071484 18:22320751-22320773 GCTGACAAGGTCCATAGGTTGGG + Intergenic
1155333757 18:24744459-24744481 CCTGACAAGACCACTTGGTTAGG + Intergenic
1156451070 18:37266776-37266798 CCTGCCAAGAGCCCTGGGCTAGG - Intronic
1158435401 18:57431933-57431955 CCTGACAAGATTTCGAGCATTGG + Intergenic
1161147328 19:2686681-2686703 CCTGAAACGATCCCAAGGAGCGG + Intronic
1162433695 19:10644212-10644234 CCTGACATCATCCCTTGGGTGGG - Exonic
926066568 2:9844687-9844709 CCAGACATGATCCCTAGTCTGGG - Intronic
927290135 2:21396991-21397013 CCTGGCAAGACCCCCAGGAGAGG + Intergenic
930673928 2:54179905-54179927 TCTGACAAGATCCCACAGATTGG + Intronic
931397113 2:61897420-61897442 CCAGCCAAGAACCCTAAGATGGG + Intronic
938087470 2:128410740-128410762 CCTGAGAAGATGCCCAGGAGGGG + Intergenic
942308042 2:174627978-174628000 CCTGAAAAGACCCCTAAGAGTGG + Intronic
946405797 2:219491514-219491536 GGTGACAAGCTCCCTTGGATCGG - Intronic
1170507349 20:17041099-17041121 CCTTACAAATTCCCTAGGGTCGG - Intergenic
1173659086 20:44720547-44720569 CCTCACAATAACCCTATGATGGG + Intronic
1174690047 20:52495067-52495089 CCTGAAAACAACCCTATGATGGG - Intergenic
1182850281 22:33468064-33468086 CCTGTCATGTTTCCTAGGATGGG + Intronic
1183466477 22:37982797-37982819 CCAGGGAAGAGCCCTAGGATAGG + Intronic
952685188 3:36139472-36139494 TCTGAAAAGGTCCATAGGATAGG + Intergenic
956282725 3:67575189-67575211 CTTGAATAGATACCTAGGATTGG - Intronic
957023578 3:75152586-75152608 CATGACAAGAAGGCTAGGATGGG + Intergenic
966618879 3:181942581-181942603 CCTGAAAAGATCCCAAAGAGAGG + Intergenic
977677404 4:99763082-99763104 CCTGAGAAGATGCCAATGATGGG - Intergenic
985711135 5:1430601-1430623 TCTGACAAGACCCCCAGGAGAGG + Intronic
988578595 5:32449450-32449472 CCTGAGTATATCCCTAGGAGTGG + Intergenic
996583721 5:125061731-125061753 TCTCACAACATCCCTAGGTTTGG - Intergenic
997505424 5:134412745-134412767 CCTGGCTAGATCCCAAGAATGGG + Intergenic
997633954 5:135390749-135390771 CCTGACAATGTCCCTAGTATAGG - Intronic
997921767 5:137986800-137986822 CCTCACAACATCCCAAGGAGAGG + Intronic
1001255509 5:170180199-170180221 CCTTACAAGGACCCAAGGATGGG - Intergenic
1001341943 5:170855215-170855237 CATGCCAAGGTCCCTAGGATTGG - Intergenic
1001528543 5:172446100-172446122 CCCGACAAGGGCTCTAGGATAGG + Intronic
1001880903 5:175243332-175243354 CCTGTCATGTTCCCCAGGATTGG + Intergenic
1003286302 6:4736609-4736631 CCTGGCAACTTCCCTAGGAGTGG + Intronic
1006500705 6:34457259-34457281 GTTGGCATGATCCCTAGGATGGG - Intergenic
1007346601 6:41236056-41236078 CCTGACCAGACCCTTAGGAGTGG - Intronic
1007421991 6:41725027-41725049 CCTGACAAGAGCCCCATGAAGGG + Intronic
1017536265 6:155350301-155350323 CCTGAATATATCCCTAGGAAGGG - Intergenic
1021725390 7:23543587-23543609 GATGACAAGATACATAGGATAGG + Intergenic
1028933606 7:96441558-96441580 CATTACAAGATCCCTGGGGTAGG + Intergenic
1031101535 7:117486625-117486647 CCTGAGAAGTTCCCTATGACGGG + Intronic
1031463153 7:122076822-122076844 TCTGACAATATCCCTAGGTCCGG - Intronic
1035242372 7:157540662-157540684 CCTGACAACATCCGTGGGGTGGG + Exonic
1037770350 8:21795279-21795301 CCTTACAACATCCCTGGGAGGGG + Intronic
1039917670 8:41871907-41871929 CCAGCCAAGATCCCTGGGAGGGG - Intronic
1040500141 8:47998370-47998392 CCAGACAAGTTCCCCAGGAAAGG - Intergenic
1047652752 8:126941378-126941400 CCTGAGAAGATGCCTAAGAAGGG - Intergenic
1048303609 8:133268309-133268331 CCTGATAAGACCCCCAGGGTTGG + Intronic
1049412733 8:142480659-142480681 CCTGACAAGAGCCACAGGACTGG - Intronic
1060142576 9:121223155-121223177 CCTGACAAGATCTCAGGAATTGG - Intronic
1061850556 9:133412470-133412492 CCTGACAAGAGCCTTAGCCTTGG - Exonic
1189306451 X:39990446-39990468 CCTCCCAAGATCCCTATAATAGG + Intergenic
1189925697 X:45952255-45952277 CCTGACAGGACTCCTAGGCTAGG - Intergenic
1196795142 X:119496196-119496218 CCGGGCTAGATCCCTAGGATAGG - Intergenic