ID: 1125527867

View in Genome Browser
Species Human (GRCh38)
Location 15:40389700-40389722
Sequence GTTAATGCACAGATGCCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 109}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125527865_1125527867 -5 Left 1125527865 15:40389682-40389704 CCTTGGATGAGCAAGCTTGTTAA 0: 1
1: 0
2: 1
3: 11
4: 103
Right 1125527867 15:40389700-40389722 GTTAATGCACAGATGCCCAAGGG 0: 1
1: 0
2: 0
3: 10
4: 109
1125527864_1125527867 -4 Left 1125527864 15:40389681-40389703 CCCTTGGATGAGCAAGCTTGTTA 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1125527867 15:40389700-40389722 GTTAATGCACAGATGCCCAAGGG 0: 1
1: 0
2: 0
3: 10
4: 109
1125527859_1125527867 20 Left 1125527859 15:40389657-40389679 CCACATGGAATCCTGATGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 134
Right 1125527867 15:40389700-40389722 GTTAATGCACAGATGCCCAAGGG 0: 1
1: 0
2: 0
3: 10
4: 109
1125527863_1125527867 -3 Left 1125527863 15:40389680-40389702 CCCCTTGGATGAGCAAGCTTGTT 0: 1
1: 0
2: 0
3: 4
4: 87
Right 1125527867 15:40389700-40389722 GTTAATGCACAGATGCCCAAGGG 0: 1
1: 0
2: 0
3: 10
4: 109
1125527862_1125527867 9 Left 1125527862 15:40389668-40389690 CCTGATGGGTGGCCCCTTGGATG 0: 1
1: 0
2: 0
3: 8
4: 84
Right 1125527867 15:40389700-40389722 GTTAATGCACAGATGCCCAAGGG 0: 1
1: 0
2: 0
3: 10
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125527867 Original CRISPR GTTAATGCACAGATGCCCAA GGG Intronic
902530616 1:17088365-17088387 GTTAATGACCAGATGCTCAAGGG + Intronic
905608663 1:39328531-39328553 GTTTAAGCACAAATGCACAAAGG + Intronic
907077605 1:51592789-51592811 GTAAATGCTCAAATGCCCAAGGG - Intronic
908512923 1:64863434-64863456 GTTAATGGAAAGATGCGAAATGG - Intronic
908630552 1:66101330-66101352 GTTACTGGACATATACCCAAAGG - Intronic
912350130 1:109004683-109004705 GTTGATGCACAGAGGCCTATCGG - Exonic
912608640 1:111019455-111019477 GCAAATGCAAAGATGCACAAAGG + Intergenic
916852011 1:168713357-168713379 CTTACTCCACAGATGCCCAGTGG - Intronic
918039741 1:180906753-180906775 CTGAATCTACAGATGCCCAAAGG - Intergenic
919704475 1:200663222-200663244 GTTAATGCCCAGAACACCAAGGG + Intronic
921301441 1:213754800-213754822 GTTGAAGCCCTGATGCCCAATGG - Intergenic
922747961 1:228057570-228057592 GTTACTCTACAGATGCCCATAGG + Intronic
1065475154 10:26128459-26128481 GTTAATGCACAGCTGCTCGAAGG - Exonic
1075020283 10:118947150-118947172 GCTAATTCATAGAAGCCCAAGGG + Intergenic
1078293660 11:10043123-10043145 GTTAATGTACAGATTCATAATGG + Intronic
1082312918 11:50676055-50676077 ATGAATGCACACATGCCAAATGG + Intergenic
1086279679 11:85171493-85171515 GGGCATGCACAGAGGCCCAAGGG + Intronic
1087186771 11:95207478-95207500 GTTAATGCAAAAAGGCCCCACGG - Intronic
1088084032 11:105956606-105956628 GTTACTGCATATATACCCAAAGG - Intronic
1088200090 11:107322711-107322733 ATCAGTGCACAGATGCTCAAAGG + Intergenic
1088892345 11:114055043-114055065 ATTAGTGCAAAGATGCCCTAAGG - Intergenic
1091450889 12:571296-571318 CTTGTTGCCCAGATGCCCAAGGG - Intronic
1092439396 12:8484866-8484888 TTTAATGCACAGAAGCAGAATGG + Intergenic
1093666133 12:21815454-21815476 ATGAATGCAAAGATTCCCAAGGG + Intronic
1094052168 12:26232330-26232352 TTTAAAGCACAAATGCCCCAAGG + Exonic
1094435836 12:30419746-30419768 ATTACTGGACATATGCCCAAAGG + Intergenic
1097646231 12:62237876-62237898 GTTCATGCACAGAAGACCAATGG + Intronic
1097752813 12:63376866-63376888 ATTCATTCACAGAAGCCCAATGG - Intergenic
1099076226 12:78112949-78112971 GTAAATACACAGATTCCAAACGG + Intronic
1100284173 12:93149208-93149230 GTTAATGCAGGGCTGCCCAGTGG + Intergenic
1102245526 12:111353374-111353396 GCTGATGAACAGTTGCCCAATGG - Intergenic
1109158455 13:58941635-58941657 GTTAATGAACATATTCTCAAAGG - Intergenic
1114399294 14:22394840-22394862 TACAATGCACAGTTGCCCAAAGG + Intergenic
1115706883 14:36008249-36008271 GAAAACGCAGAGATGCCCAAAGG + Intergenic
1120003471 14:79330198-79330220 GTTAATAGACAGATGAACAAGGG + Intronic
1125463247 15:39926102-39926124 TTTAATTCAAAGATGCCCAGAGG - Intergenic
1125527867 15:40389700-40389722 GTTAATGCACAGATGCCCAAGGG + Intronic
1126462080 15:48925100-48925122 GTTAATGGACACATGCCTAAAGG + Intronic
1127271892 15:57409092-57409114 ATTAATGCACACATGCCTGAGGG - Intronic
1130633302 15:85591773-85591795 TTCAATGAACAGATGCCCCAGGG - Intronic
1131367931 15:91854856-91854878 GTTAATGCTCAGAGGGCCCATGG + Intronic
1134631295 16:15757971-15757993 GTTGATGCACAGCTGCTCGAAGG + Exonic
1139778559 16:69331988-69332010 GTTGAGGCACAGCTTCCCAAAGG - Intronic
1140947929 16:79787950-79787972 GTAAATGCACAGATTACAAAAGG + Intergenic
1143405849 17:6676817-6676839 GATCATGCACAGGTGCCCCATGG + Intergenic
1146629981 17:34462894-34462916 GCAAATGCTCAGAGGCCCAAGGG - Intergenic
1148244022 17:46018760-46018782 ATTAATGCCCATATACCCAAGGG - Intronic
1148645047 17:49215210-49215232 GTTCAGGAACAGAAGCCCAATGG + Intronic
1150991366 17:70263722-70263744 GTCAATGCACAGACTCCCATGGG + Intergenic
1156047184 18:32889915-32889937 GTTAATGCACAGCTTCCTATTGG + Intergenic
1156059876 18:33062228-33062250 GCTAATGCATATATTCCCAAAGG - Intronic
1157062885 18:44313523-44313545 TTTAATGAACAGATGTCCATGGG - Intergenic
1159152133 18:64534424-64534446 GTAAATACACACATTCCCAATGG - Intergenic
1164981077 19:32615066-32615088 GCTTATGAACAGATGCTCAAGGG - Intronic
928906030 2:36368629-36368651 ATTAATGAATAAATGCCCAATGG - Intronic
931197182 2:60063945-60063967 TTTTATGCACAGCTGCCCGAAGG + Intergenic
933749024 2:85591343-85591365 ATCAATGCACAGCTGCCCTAAGG - Intronic
935743411 2:106170702-106170724 GTTGCTGCACAGATTCCAAAGGG + Intronic
942899957 2:181103432-181103454 GTTGATGCCCAGATGTCCAAAGG - Intergenic
943528375 2:189047468-189047490 TTTAATATACAAATGCCCAATGG + Intronic
943907958 2:193524835-193524857 GTTACTGGATATATGCCCAATGG + Intergenic
1171329334 20:24323907-24323929 GTTGAGGCACAAATGCCCAGTGG - Intergenic
1180942504 22:19668554-19668576 GTGAATGCACATATGAGCAAGGG - Intergenic
1185137485 22:49081030-49081052 GTTCATGGACAGATGCACTATGG + Intergenic
1185194306 22:49459211-49459233 GTCAATGAACAGCTGGCCAAGGG + Intronic
949939181 3:9141261-9141283 GTGAATGCACACATGGCCAGAGG - Intronic
954180961 3:48881068-48881090 GCTTATGAACAGATGCCAAATGG + Intronic
955776514 3:62439623-62439645 TTTGATGCACAGTTGCCAAACGG - Intronic
958068282 3:88574208-88574230 GTAAAGGCACAGAAGCCCAAGGG - Intergenic
960420687 3:117441715-117441737 GTTCATGTACTGATGCCCAGGGG - Intergenic
961948092 3:130714946-130714968 GTTACTGGACATATACCCAAAGG - Intronic
962357597 3:134708237-134708259 ATTAATGCAAAGATGGCAAATGG - Intronic
962987870 3:140552248-140552270 GTCACAGCACAGATACCCAAGGG + Intronic
966318982 3:178679741-178679763 GTTAAAATAAAGATGCCCAAAGG + Intronic
966582664 3:181585900-181585922 ATTACTGCACATATACCCAAAGG - Intergenic
971142769 4:23942710-23942732 GTGAGTTCACAGATGCCAAATGG - Intergenic
974360842 4:60877129-60877151 GTTACTGCATATATACCCAAAGG + Intergenic
974944157 4:68505841-68505863 GTTACTGGATATATGCCCAAAGG + Intergenic
976081203 4:81356928-81356950 ATTACTGCATATATGCCCAAAGG + Intergenic
977189581 4:93982920-93982942 CTGAATGCACAGTTGGCCAATGG - Intergenic
977736232 4:100419769-100419791 GTTTATTCACTGATTCCCAAAGG + Intronic
992375583 5:76185026-76185048 GTAAATACACAGATTCCCAATGG + Intronic
993061947 5:83049207-83049229 GTTATAGCACAAATGCCAAAAGG - Intergenic
993273844 5:85831011-85831033 GTTATTGCATATATACCCAAAGG - Intergenic
998513346 5:142731946-142731968 GTTGATGCCCAGAGACCCAAAGG - Intergenic
998598725 5:143562338-143562360 GTAAATGCAGAGGAGCCCAATGG + Intergenic
1000905024 5:166955339-166955361 GTTAATGGAAAGAAACCCAATGG + Intergenic
1010603359 6:77858315-77858337 GTTAATGCATTAATGCTCAAAGG + Intronic
1010831303 6:80533676-80533698 ATTAAGGCACATATCCCCAATGG + Intergenic
1012353061 6:98277446-98277468 GTTTCTGGACAGATGGCCAATGG + Intergenic
1012377958 6:98585424-98585446 GCAAATGGACAGATGACCAAAGG + Intergenic
1015728963 6:136328482-136328504 ATTAATTCACAGACGCCCATTGG + Intergenic
1018037464 6:159893519-159893541 GTAAATGCATAGAGGGCCAAGGG + Intergenic
1020571086 7:9862655-9862677 ATTATTGCACATATACCCAAAGG + Intergenic
1023647245 7:42330699-42330721 TTTAAAGCAAATATGCCCAAAGG + Intergenic
1023896993 7:44442341-44442363 GTCAATGCACAGCTGCCACATGG + Intronic
1024253529 7:47523438-47523460 CTCAGTGCACATATGCCCAAGGG + Intronic
1031827817 7:126588444-126588466 ATTACTGGACATATGCCCAAAGG + Intronic
1032517115 7:132514945-132514967 GCAAAGGCACAGATGCCCAGAGG - Intronic
1034586125 7:152093974-152093996 GTTAATGCTCAGAGAACCAACGG - Intronic
1036608863 8:10332772-10332794 ATTAATGAACAAATGCCCAAGGG - Intronic
1040619066 8:49069629-49069651 ATTACTGGACATATGCCCAAAGG + Intronic
1040776316 8:51047198-51047220 TTAAAGGCACAGATGTCCAATGG + Intergenic
1041308032 8:56484014-56484036 GTAAATGCACAAATGATCAATGG + Intergenic
1046408182 8:113802874-113802896 GTATATGCACAGATCCCAAAAGG + Intergenic
1048698412 8:137055642-137055664 GAAAATGCACTGATGCCCATGGG + Intergenic
1050318102 9:4423689-4423711 GTTATTGCACAAATGCCATAAGG + Intergenic
1050380536 9:5023589-5023611 GTTAAGTTAGAGATGCCCAATGG - Intronic
1062060044 9:134490400-134490422 GTTCATATACGGATGCCCAATGG + Intergenic
1186084072 X:5967561-5967583 GTTCATGCACAGAAGCAGAAAGG - Intronic
1188087169 X:25913729-25913751 GTCAATGAACAGATACCAAATGG - Intergenic
1188344163 X:29043748-29043770 GTGAATGTAAAGATACCCAATGG + Intronic
1190909426 X:54757961-54757983 GTCAATGCCCACATACCCAAAGG - Exonic
1195546275 X:106115742-106115764 GTAAATGCACACATGCCAGAGGG - Intergenic
1195584361 X:106547760-106547782 GTTAATACACAGAAACTCAATGG + Intergenic
1196089818 X:111727681-111727703 GGGAATGGACAGATGCCCAGGGG + Exonic
1197505617 X:127300060-127300082 GTTACTGCATACATGCCCACAGG + Intergenic
1199046294 X:143177845-143177867 GGTTATGCACAGATCACCAAAGG + Intergenic
1199575403 X:149308780-149308802 ATTAATTCACAGTTGCCCAAGGG - Intergenic
1200762610 Y:7053972-7053994 GTTTAGGCACTGCTGCCCAAGGG + Intronic