ID: 1125530489

View in Genome Browser
Species Human (GRCh38)
Location 15:40410128-40410150
Sequence AAGAAGCAGGACTGGAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 885
Summary {0: 1, 1: 1, 2: 6, 3: 82, 4: 795}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125530489_1125530497 17 Left 1125530489 15:40410128-40410150 CCTGGCCTCCAGTCCTGCTTCTT 0: 1
1: 1
2: 6
3: 82
4: 795
Right 1125530497 15:40410168-40410190 TATAAAATCTCACCTTCCTCAGG 0: 1
1: 0
2: 3
3: 21
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125530489 Original CRISPR AAGAAGCAGGACTGGAGGCC AGG (reversed) Intronic
900324447 1:2101385-2101407 AGGAAGGAGGGCTGGGGGCCGGG - Intronic
900339427 1:2181059-2181081 AAGCAGCAGGGCTGGGGGGCTGG - Intronic
900558575 1:3292229-3292251 GAGTAACAGGACTTGAGGCCGGG - Intronic
900655670 1:3755609-3755631 AAGAAGCAGGCCTCGAGCTCAGG - Intronic
901130821 1:6961957-6961979 AAGACGCTGGACTGGCCGCCGGG - Intronic
901147160 1:7072987-7073009 AAGAAGCAAGAGTGTAGGCAGGG + Intronic
901262678 1:7885535-7885557 AGGCAGCAGGAGTGGAGGCTGGG - Intergenic
901736729 1:11317333-11317355 CAGAAGGATGACTTGAGGCCAGG - Intergenic
901792173 1:11659721-11659743 CAGAAGGATGACTTGAGGCCAGG - Intronic
901917662 1:12512319-12512341 AAGAAACAGCAAAGGAGGCCGGG + Intergenic
902282913 1:15387519-15387541 CAGAAGGATGACTTGAGGCCAGG + Intronic
902747788 1:18484737-18484759 AAGAAGCAGGACTGGAACAAAGG + Exonic
902873285 1:19326777-19326799 CAGAAGCAGAAATGGAGGCTCGG - Intronic
903112672 1:21150117-21150139 AAGAAGCAGGAGGGGAAGCTTGG - Intronic
903179190 1:21597007-21597029 TGGAAGCAGGACTGGGGGTCTGG - Exonic
903556274 1:24195894-24195916 AAGAAGCGGGAGAGGAGGCGAGG + Intergenic
903627384 1:24741307-24741329 CAGAAGCAGGATTGGAACCCAGG + Intergenic
903808111 1:26019851-26019873 AAATGGCAGGACTGGAGGCAGGG - Intergenic
904002313 1:27345717-27345739 AAGAGGCAAGCCTGGAGGCAGGG - Intronic
904029211 1:27523533-27523555 CAGAACCAGGACTGGAATCCAGG + Intergenic
904247768 1:29199986-29200008 AGGAAGCATCACTTGAGGCCAGG - Intronic
904284372 1:29444484-29444506 TAGAGGCAGGACTAGGGGCCTGG + Intergenic
904349529 1:29895896-29895918 AGGAAGCTGTACAGGAGGCCAGG + Intergenic
904921249 1:34009936-34009958 AGGATGCAAGACTGGAGGCTGGG - Intronic
905279640 1:36841035-36841057 AAGAACCGGGACTCGAGCCCAGG + Intronic
905411591 1:37773423-37773445 AAGAAGGATCACTTGAGGCCAGG + Intergenic
905592094 1:39173045-39173067 TAGAAAAAGCACTGGAGGCCGGG + Intronic
905774427 1:40659458-40659480 AAAAGGCAGGCCTGGAGGCAAGG + Intronic
906383616 1:45348362-45348384 AGGAAGGAGGAAGGGAGGCCAGG - Intronic
906532372 1:46531145-46531167 AAGAGACAGGACTGGAGCCTGGG + Intergenic
906557575 1:46725878-46725900 ATGAAGCAGGAATGGAGGACAGG + Intergenic
907479763 1:54737296-54737318 AAGAATCAAGACTCAAGGCCAGG - Intronic
907651089 1:56295426-56295448 AAGAAGCAGGAGTGAGGGACAGG - Intergenic
908139862 1:61173306-61173328 ATGAACCAGGGCAGGAGGCCAGG - Intronic
911143801 1:94533397-94533419 AAGAAGCAGGCGTGGCGGCCTGG + Intronic
912411742 1:109484647-109484669 AAGAGGCAGGGCAAGAGGCCTGG - Intronic
913066441 1:115260202-115260224 CAGAGGCAGGATTTGAGGCCAGG - Intergenic
913507866 1:119534683-119534705 TAAAAGCAGCCCTGGAGGCCAGG + Intergenic
913702182 1:121384163-121384185 AAAAAGGAGGAGTGGACGCCGGG + Intronic
913957910 1:143320654-143320676 AAGGACCAGGACTGGGGTCCAGG + Intergenic
913975934 1:143455438-143455460 AAGAAGCAGAATGGGAGGCAGGG + Intergenic
914042740 1:144064632-144064654 AAAAAGGAGGAGTGGACGCCGGG + Intergenic
914052219 1:144146012-144146034 AAGGACCAGGACTGGGGTCCAGG + Intergenic
914070330 1:144281060-144281082 AAGAAGCAGAATGGGAGGCCGGG + Intergenic
914108825 1:144685294-144685316 AAGAAGCAGAATGGGAGGCCGGG - Intergenic
914126978 1:144820529-144820551 AAGGACCAGGACTGGGGTCCAGG - Intergenic
914135346 1:144895856-144895878 AAAAAGGAGGAGTGGACGCCGGG - Intronic
914289906 1:146263508-146263530 AAAAAGCAGTTCTGGAGGGCAGG + Intergenic
914550949 1:148714291-148714313 AAAAAGCAGTTCTGGAGGGCAGG + Intergenic
915591740 1:156874785-156874807 ATGAGGCAGGTCTGGAGACCTGG + Intronic
916172739 1:162012975-162012997 AGGCAGCAGGACTAGAGGCATGG - Intronic
917199721 1:172501609-172501631 CAGGAGCATGGCTGGAGGCCAGG - Intergenic
917320068 1:173771526-173771548 TAGAAGTACGACTTGAGGCCAGG + Intronic
918206019 1:182310090-182310112 AAGAAGCAGGGTAGGAAGCCTGG + Intergenic
918222893 1:182452129-182452151 AAGGAGCAGGTTGGGAGGCCTGG + Intronic
918293776 1:183135646-183135668 AGGAAGGATCACTGGAGGCCAGG + Intronic
918425193 1:184402391-184402413 CAGAAGGAGCACTTGAGGCCAGG + Intronic
919495484 1:198261300-198261322 CAGAATCAGGACTTGAAGCCAGG - Intronic
919843390 1:201625621-201625643 AAGAAGCAGAAATGCAGGGCAGG + Intronic
920044138 1:203122583-203122605 AAGCATGGGGACTGGAGGCCCGG - Intronic
920099465 1:203507886-203507908 AGGAAGCAGGAAGGGAGTCCAGG - Intronic
920196719 1:204232758-204232780 AAGAGGCAGGCCTAGAGGCAGGG + Intronic
920414495 1:205789699-205789721 CAGAAGGAGGCCTGGAGGTCTGG + Exonic
920489603 1:206402878-206402900 AAAAAGGAGGAGTGGACGCCGGG + Intronic
920698625 1:208200899-208200921 ATCAAGAAGGATTGGAGGCCAGG - Intronic
920761533 1:208787702-208787724 AAGAGACAAGCCTGGAGGCCAGG - Intergenic
920833410 1:209485613-209485635 AAGAGGCAGGACTCTGGGCCTGG + Intergenic
921033550 1:211354676-211354698 AAGAAGCAGGAGAGGAGACTTGG - Intronic
921635928 1:217493158-217493180 AGGAAGCAGGCCTGGAAGCAGGG - Intronic
921891676 1:220360067-220360089 AGGAAGCAGTACAGTAGGCCGGG - Intergenic
921997463 1:221436714-221436736 TAGAAACAGGATGGGAGGCCAGG - Intergenic
922476282 1:225908902-225908924 GAGAAGCAGGTGTGGAAGCCAGG - Intronic
922569474 1:226625539-226625561 GACAGGCAGGACTGGAGGGCAGG - Intergenic
922616627 1:226964804-226964826 CAGAAGCAGGGCTGGAGCCCAGG + Intronic
923046955 1:230362529-230362551 AAGAAGCTGGCCTGGGGGTCAGG - Intronic
923413063 1:233729394-233729416 AAGAAACAGGGCTGGCGGCCGGG + Intergenic
923642129 1:235774341-235774363 AAGAAGTAGGGGTGGAGGCAAGG + Intronic
923676100 1:236081943-236081965 AAGGAGCAGGCCAGGAGGCAGGG - Intergenic
923773394 1:236957433-236957455 CAGCAGCAGGACCGCAGGCCAGG - Intergenic
924329455 1:242927551-242927573 AAGAATCAACACTGCAGGCCAGG + Intergenic
924334229 1:242970955-242970977 TAGAAGAATCACTGGAGGCCAGG + Intergenic
924453980 1:244203390-244203412 CAGAAGCAGGACTGGCAGCCGGG - Intergenic
1062822139 10:542379-542401 AAGTAGCAGCACTGGAGGAATGG - Intronic
1062858278 10:790411-790433 CAGAAACAGGTTTGGAGGCCGGG - Intergenic
1062956506 10:1543749-1543771 AAGAAGAAGGAACGCAGGCCCGG - Intronic
1063252876 10:4293436-4293458 AAGAAGCAGGGTAGGAGTCCTGG - Intergenic
1063632982 10:7751483-7751505 CAGGAGCATCACTGGAGGCCAGG + Exonic
1064330780 10:14392038-14392060 AAGAAGCAGGAATGGGGCACAGG + Intronic
1064716421 10:18181388-18181410 AAGATGCAAGACTGTAGCCCTGG + Intronic
1065871016 10:29956458-29956480 CAGAGGCAGGACTGGAGCACAGG - Intergenic
1068171847 10:53404326-53404348 AAGAAACCAGACTGCAGGCCTGG + Intergenic
1068514331 10:58007220-58007242 CAGGAGAAGGACTGCAGGCCAGG - Intergenic
1068815449 10:61305418-61305440 AAGAAGTAAGAGAGGAGGCCGGG + Intergenic
1069500408 10:68948001-68948023 GAAAAGCCAGACTGGAGGCCTGG + Intergenic
1069603951 10:69728321-69728343 AAGAACCAGGACTGGAGGAAGGG - Intergenic
1069726035 10:70579613-70579635 CAGAAGGATGAATGGAGGCCAGG - Intergenic
1069739113 10:70676230-70676252 CAGAAGGATGGCTGGAGGCCAGG - Intronic
1069774437 10:70918569-70918591 AAGCAGCAGGAACGGAGCCCGGG + Intergenic
1069856278 10:71442891-71442913 GGGAGGCAGGACTGGAGGGCAGG + Intronic
1069947405 10:71997498-71997520 AGAGGGCAGGACTGGAGGCCAGG - Intronic
1070154513 10:73825176-73825198 AAGGAACAGGCCAGGAGGCCAGG + Intronic
1070585794 10:77765019-77765041 CAGGAGGATGACTGGAGGCCAGG + Intergenic
1070694909 10:78555199-78555221 ATAAAGCAGGGCAGGAGGCCAGG - Intergenic
1070890126 10:79936915-79936937 AAGAGGCAGCAATGGAGGCTGGG + Intergenic
1071595352 10:86918375-86918397 AAAGAGCAGGACTGTGGGCCTGG + Intronic
1071854558 10:89610266-89610288 TAGAAACAGGACTGGAGTTCAGG + Intronic
1071986745 10:91059307-91059329 AAGGAGCAGGAATGTAGGGCAGG + Intergenic
1072331019 10:94351821-94351843 AAGAAGGATAACTAGAGGCCAGG - Intronic
1073042820 10:100618893-100618915 AGGAGGCTGGACAGGAGGCCAGG - Intergenic
1073580205 10:104658648-104658670 AAGAAAGGGGACTTGAGGCCAGG - Intronic
1074888797 10:117717695-117717717 AAGAAGAAGGAGTGGAGGGAAGG - Intergenic
1075032189 10:119030666-119030688 AAGAAGCTGCGCTGAAGGCCCGG + Exonic
1075106349 10:119542515-119542537 AAGAGGGAGGGCAGGAGGCCGGG + Intronic
1076078605 10:127557534-127557556 AAGATGCAGGCTGGGAGGCCAGG - Intergenic
1076112072 10:127867792-127867814 AAGAAGGATAACTTGAGGCCAGG + Intergenic
1076307052 10:129472769-129472791 TGGAGGCAGGACTGGAGGTCGGG + Intronic
1076386283 10:130058268-130058290 CAGATGCTGGAGTGGAGGCCAGG + Intergenic
1077054175 11:582511-582533 AAAAAGGAGGACTACAGGCCAGG - Intronic
1077474374 11:2779440-2779462 TGGAAGCAGGAGTGGAGGCTGGG - Intronic
1078018012 11:7631982-7632004 AAGAGGCAGTACTGGAGACATGG + Intronic
1078337836 11:10477743-10477765 GAGCAGCAGGGCTGGAGGCTGGG + Intronic
1078417939 11:11180872-11180894 CAGAAGCAGGACTAGGGTCCAGG - Intergenic
1078550194 11:12274927-12274949 AAGAGGCAGGGACGGAGGCCAGG + Intergenic
1078758600 11:14234052-14234074 AAGAAACAGCACTGGGGGTCGGG - Intronic
1079137559 11:17784562-17784584 ATGAAGTAGGGCAGGAGGCCAGG - Intergenic
1080224605 11:29946339-29946361 AAGAATTAGGACTTGAGCCCAGG + Intergenic
1080511871 11:32982793-32982815 AACAGGAAGGACTGGAGGCAAGG - Intronic
1080559616 11:33450977-33450999 AGGGAGTAGGTCTGGAGGCCAGG - Intergenic
1081159505 11:39735259-39735281 AAGAAGGAGGAATGGAGGGTGGG - Intergenic
1081193872 11:40137527-40137549 AAGAAGAAGGAAAGGAGGCAAGG - Intronic
1081255011 11:40881932-40881954 AAGAAGTAAGACTGGAAGCAGGG - Intronic
1081378371 11:42386530-42386552 AAGAAGCATGACTGGAAAACTGG + Intergenic
1081674634 11:44961576-44961598 AAGAAAGAGCACTGGAGGCCAGG - Intergenic
1081710094 11:45210794-45210816 CAGAAGCAGGACTTGAACCCGGG + Intronic
1081796927 11:45826880-45826902 TTGAAGCAGGAGTGAAGGCCAGG - Intergenic
1081847819 11:46253349-46253371 GAGGAACAGGCCTGGAGGCCTGG - Intergenic
1081850681 11:46273198-46273220 CAGAGGCAGGACTGGAGGGGAGG - Intergenic
1082006804 11:47423831-47423853 CAGAGCCAGGACTGGAGCCCAGG - Intronic
1082008291 11:47433374-47433396 AAGGAGGAGGAGTGGAGGCCAGG - Intergenic
1082946021 11:58761151-58761173 AAATAGTAGGAATGGAGGCCAGG - Intergenic
1082953513 11:58844071-58844093 TAGAAGCAGGATTGGAGGCAAGG + Intronic
1082969913 11:59009327-59009349 TAGAAGCAGGATTGGAGGCAAGG + Intronic
1083485177 11:62978967-62978989 AAGAAACAAGAATGGGGGCCCGG - Intronic
1083735689 11:64679340-64679362 AAGAATCAGGATTGAGGGCCAGG + Intronic
1083956699 11:65987783-65987805 AAGAAGCAGGACAGATGGGCAGG + Intergenic
1084045885 11:66567676-66567698 AAGAAGCTGCTCTGGGGGCCTGG + Intronic
1084209038 11:67612467-67612489 TAGACGCAGGACAGCAGGCCAGG - Exonic
1084386583 11:68846632-68846654 AAGAAGCAAGAATGGAGGTCAGG + Intergenic
1084616104 11:70236869-70236891 CAGAAGAAAAACTGGAGGCCGGG + Intergenic
1085051764 11:73383648-73383670 ATGAAGCAGGAATGGAGCCCAGG - Intronic
1085743508 11:79096075-79096097 AAGAAGCAGCATTGGAATCCAGG - Intronic
1085845184 11:80056861-80056883 AAGAACCAGGACTCAAGCCCAGG + Intergenic
1086057180 11:82660586-82660608 AAGATGTAGGCCGGGAGGCCAGG + Intergenic
1087500696 11:98949641-98949663 TAGAAGCAGGAGTGGAGATCGGG - Intergenic
1087531647 11:99389321-99389343 GAAAATAAGGACTGGAGGCCAGG - Intronic
1087620329 11:100533698-100533720 CAGGAGGATGACTGGAGGCCAGG + Intergenic
1088582814 11:111331735-111331757 AAGAAGCAGGCCTGGAAGACAGG + Intergenic
1089255896 11:117193731-117193753 AAGGAGCAGTCCTGAAGGCCTGG + Intronic
1089556677 11:119319107-119319129 AGGACGCAGGAGTGGAGGCAGGG + Intronic
1089678572 11:120106943-120106965 GAGGAGCAGGAATGGAGGCGTGG - Intergenic
1089838211 11:121390746-121390768 TAAAAGAAGTACTGGAGGCCAGG + Intergenic
1090092368 11:123709723-123709745 AAGAAGCATCAGAGGAGGCCAGG - Intergenic
1090226189 11:125073494-125073516 AGGAAGAAGGACTGGAGGGGTGG - Intronic
1090379637 11:126317252-126317274 AAGAAAGAGGCCGGGAGGCCGGG - Intronic
1090405611 11:126474400-126474422 CAGAGCCAGGGCTGGAGGCCAGG + Intronic
1090633175 11:128668548-128668570 AAGAAGAGGGACTGGAAGCCAGG + Intergenic
1090661573 11:128885952-128885974 AAGAGGCAGGAATGGATGTCTGG - Intergenic
1090883755 11:130858109-130858131 AAGAGCCAGGAGTGGAGGACAGG - Intergenic
1091297162 11:134482116-134482138 AAGATGCAGGGCTGGAGTCCAGG + Intergenic
1091585325 12:1812720-1812742 CAGAAGCAGGACTGCAGCCTGGG + Intronic
1092006093 12:5071627-5071649 AAGGACCAGGACTGGAGCCCTGG - Intergenic
1092853912 12:12655203-12655225 ATGATGCAGGTCTGGAGGTCTGG - Intergenic
1094203577 12:27817377-27817399 AAGAAGAAGGAGGGGAGGGCAGG - Intergenic
1094288549 12:28820078-28820100 GAGAATCAGGTCTGGAGGCAGGG - Intergenic
1095375156 12:41518722-41518744 AAGGAGCATGGCTTGAGGCCAGG + Intronic
1095761433 12:45842028-45842050 CAGAAGGATCACTGGAGGCCAGG + Intronic
1095803836 12:46296711-46296733 AAGCAGAAGGACTGGAGGCAGGG - Intergenic
1096586549 12:52626298-52626320 TAGAACCAGGACTGGAAGCCAGG + Intergenic
1096651865 12:53065807-53065829 AAGGAGCAGGTCTGGAGGGGAGG + Exonic
1096925083 12:55135377-55135399 CAGAAGCAGGACTGGTGGGCTGG - Intergenic
1097028088 12:56073066-56073088 AAGAAGCAGGACTGGACAGAAGG - Intergenic
1097905744 12:64918024-64918046 AAGCAACAAGAGTGGAGGCCAGG + Intergenic
1098391479 12:69973900-69973922 AAGAGGTAGGTCTGGAGGTCAGG + Intergenic
1099133609 12:78865113-78865135 AGGAAGCGGGACTGGCGGCGCGG + Intronic
1099933920 12:89103416-89103438 AAAAAAGAGTACTGGAGGCCGGG - Intergenic
1100370919 12:93967715-93967737 AAGAAGCAGGACTCGACTGCAGG + Intergenic
1101002296 12:100368610-100368632 AAGAAGCAGGAAAGTATGCCCGG - Intronic
1101146276 12:101843752-101843774 TAGAAGCAGGAGTAGATGCCAGG - Intergenic
1101527215 12:105542291-105542313 AGGATGCAGGGATGGAGGCCAGG + Intergenic
1101603371 12:106229661-106229683 ATGAAGGAGGACTGGATGCTGGG + Intergenic
1102436151 12:112925443-112925465 CAGAAGCAGGATTTGAGCCCAGG - Intronic
1102879419 12:116472801-116472823 AGGAAGTAGGAGTGGAGGCTGGG - Intergenic
1102890617 12:116555974-116555996 AAGGAGCAGGATTGGAGGTGGGG + Intergenic
1103026602 12:117579297-117579319 AAGAAACAGGACTGGAATCCAGG - Intronic
1103082360 12:118035335-118035357 AAGAAACAGGATGGCAGGCCTGG + Intronic
1103239233 12:119399207-119399229 AAGAACCAGCTCTGGAAGCCTGG + Intronic
1103320427 12:120089675-120089697 AAGAAACAGAAGTTGAGGCCGGG - Intronic
1103565480 12:121813097-121813119 CAGAAGAAGGTCTGGAGCCCAGG - Intronic
1104055937 12:125230091-125230113 AAGAAGGAGGACTGGAGCCCGGG + Intronic
1104535806 12:129617030-129617052 AATCAGCAGGGCTGAAGGCCAGG + Intronic
1104575585 12:129963308-129963330 CAGAAGCAGGAGGGGAAGCCAGG - Intergenic
1104709392 12:130974830-130974852 AAGAAGCAGGGGTGGAGGGAGGG - Intronic
1105351867 13:19623164-19623186 CAGAAGCATCACTTGAGGCCAGG + Intergenic
1105376426 13:19849349-19849371 AAGAAGGATCACTTGAGGCCAGG - Intronic
1105623489 13:22091044-22091066 TGGAAGCAGCACTGGAGACCTGG + Intergenic
1107385160 13:39900197-39900219 AAGAAGTTGGACTGGAATCCAGG - Intergenic
1107387799 13:39931405-39931427 GAGAAGAAGGAAGGGAGGCCTGG + Intergenic
1108202546 13:48057644-48057666 AAGAAGAGGGAATGGAGGGCGGG - Intronic
1108394807 13:49981824-49981846 ATGAAGCAGGAAAGGAGACCAGG + Intergenic
1108571038 13:51751457-51751479 AATAAGCAGGAAGGGAGGCAGGG - Intronic
1109104975 13:58239411-58239433 CAGAAGCAGGACAGCTGGCCTGG - Intergenic
1109164384 13:59015592-59015614 TAGAAGCAAGACTGGAGGCAGGG + Intergenic
1110248657 13:73356658-73356680 AGGAAGCAAGACTGGAGACAAGG + Intergenic
1110750586 13:79110395-79110417 AAGATGCAGGCCGGGAGGCCAGG - Intergenic
1110773959 13:79384482-79384504 AAGAAGGATCACTTGAGGCCAGG - Intronic
1110809083 13:79791707-79791729 CAGGAGCTGGACTGGAGGCTGGG + Intergenic
1111242437 13:85493081-85493103 AAGAAATAAGAATGGAGGCCAGG + Intergenic
1112159226 13:96850947-96850969 AAGAGGCAGAACTAGAAGCCAGG - Intergenic
1112917821 13:104572807-104572829 AAGGAGGATGACTTGAGGCCAGG + Intergenic
1113443956 13:110351368-110351390 AAGAAGCAGGAGAGAAGGCTGGG - Intronic
1113573142 13:111373003-111373025 ATGAAGAACCACTGGAGGCCGGG - Intergenic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1114185583 14:20399186-20399208 CAGAATTATGACTGGAGGCCAGG - Intronic
1114654893 14:24310224-24310246 AGCAAGCAGGATTGGGGGCCTGG - Exonic
1115059794 14:29174489-29174511 AAGAAGCATGACTGGAAAACTGG + Intergenic
1115474173 14:33798460-33798482 AAGAAGCCTGACTGGCAGCCTGG - Intronic
1115643755 14:35352526-35352548 GAAAAGCAGGAATGGAGGCTGGG + Intergenic
1115773038 14:36686413-36686435 CAGAAGCAGAACTGGAGCTCAGG + Intronic
1116069826 14:40029773-40029795 AGGTAGGAGGACTTGAGGCCAGG - Intergenic
1116767745 14:49092668-49092690 AGGAAGCAGGAGTGGAGGACAGG - Intergenic
1116913674 14:50499360-50499382 TAGAAGCAGTATTGGGGGCCAGG + Intronic
1117579971 14:57142556-57142578 AAGGAACAGGACTGGAAGACTGG - Intergenic
1117869578 14:60186379-60186401 AAGTAGGAGGATTGGAGGCCAGG - Intergenic
1117954651 14:61113070-61113092 CAGAGGCAGGCCTGGAGTCCAGG - Intergenic
1118039410 14:61900914-61900936 AAGAAGGTGGACTGGATGCCAGG + Intergenic
1118615904 14:67574342-67574364 CCGAAGCAGAGCTGGAGGCCCGG - Exonic
1119885222 14:78134715-78134737 AAGAAGTGGGACAGGAGGGCAGG - Intergenic
1120830058 14:88989937-88989959 AAGGGGCAAGACTGGAGGCAAGG - Intergenic
1121247623 14:92473723-92473745 AAGCAGCAGGTCTGAAGGTCAGG - Intronic
1121628056 14:95401170-95401192 AACAAGCAGGCCTGGTGGCAGGG + Intergenic
1122177908 14:99934716-99934738 AAAAAGAAGGACTGGAAACCTGG - Intronic
1122694498 14:103546179-103546201 AAGAAGCGAGGCTGGAGGGCAGG + Intergenic
1123000026 14:105288492-105288514 AAGAAGCTGGAGTGGTGGCCGGG + Intronic
1202930472 14_KI270725v1_random:29420-29442 AAGGACCAGGACTGGGGTCCAGG - Intergenic
1123987944 15:25661541-25661563 AAGAAGCAGGTGTGGGGGGCTGG - Intergenic
1124892356 15:33744978-33745000 AGGCAGCAAGACTGGAGGCTGGG + Intronic
1125213365 15:37240663-37240685 AAGAAGGAGGAATGGAGGGAGGG + Intergenic
1125530489 15:40410128-40410150 AAGAAGCAGGACTGGAGGCCAGG - Intronic
1125621631 15:41068192-41068214 CAGAAGGATGACTAGAGGCCAGG + Intronic
1125720423 15:41842582-41842604 AAGAAGCAGGGTGAGAGGCCTGG + Exonic
1125849935 15:42893264-42893286 AGGCAGGAGGACTTGAGGCCAGG + Intronic
1126172947 15:45709188-45709210 AGGAAGCAGGAGTTCAGGCCTGG + Intergenic
1126790413 15:52216438-52216460 CAGAAGTATGACTTGAGGCCAGG - Intronic
1127590665 15:60419141-60419163 AATATACAGCACTGGAGGCCGGG - Intergenic
1127658280 15:61076031-61076053 TAGAAGCAGGGCTAGAGGGCGGG - Intronic
1127958357 15:63872209-63872231 AAGAAGGATGACTGAAGGACAGG + Intergenic
1128352351 15:66899626-66899648 AAGAAAAAGAAATGGAGGCCAGG - Intergenic
1128414038 15:67427509-67427531 TAGAAGAAGAGCTGGAGGCCAGG - Intronic
1128682778 15:69663676-69663698 AAGGGGCAGGGCTGGAGTCCTGG - Intergenic
1128716516 15:69912540-69912562 AAGGAGCACGGATGGAGGCCAGG - Intergenic
1128725545 15:69985830-69985852 AGGAAGTAGGACTGGAGGCTGGG + Intergenic
1129131869 15:73505825-73505847 AAGAAGGAGAAGTGCAGGCCGGG - Intronic
1129336737 15:74856568-74856590 AAAAAAAAGAACTGGAGGCCAGG - Intronic
1129421505 15:75431069-75431091 AAGAAGAAGCACTTGAGGCCGGG - Intronic
1129457387 15:75683116-75683138 CCGCAGCAGGACTGGAGCCCTGG - Intronic
1129506647 15:76087051-76087073 CAGAAGAGGGACTGGAGGCAGGG - Intronic
1129667255 15:77586234-77586256 AAGAGACAGGAGTGGAGGCAGGG + Intergenic
1129693949 15:77730039-77730061 AAAACTCAGGACTGGAGGTCCGG + Intronic
1129856739 15:78830423-78830445 AGGAAGCAGGGCTGGCGGGCAGG + Intronic
1130301490 15:82682346-82682368 AAGAAGAAGGGCTTGGGGCCGGG - Intronic
1130352770 15:83106798-83106820 AGGAAGCATTCCTGGAGGCCAGG - Intergenic
1130786456 15:87102069-87102091 AAGAATCAGGGCTGGAAGACTGG + Intergenic
1131174894 15:90203299-90203321 AAGTAGCAAGACAGCAGGCCTGG - Intronic
1131852783 15:96560711-96560733 AGGAGGCAGGAATGGATGCCAGG - Intergenic
1131961292 15:97792564-97792586 ATGCAGCAGAACTGGAGCCCTGG + Intergenic
1132094986 15:98977060-98977082 TGGAACCAGGCCTGGAGGCCAGG + Intronic
1132497750 16:271691-271713 AAGGGGCGGGACTGGGGGCCTGG - Intronic
1132703045 16:1230063-1230085 AAGACCCAGGCCTGCAGGCCTGG - Intronic
1133007882 16:2894795-2894817 AGGATGCAGGACTGGAGTACAGG - Intronic
1133849008 16:9484431-9484453 AAAAAGAAGGAATGGAGTCCAGG - Intergenic
1134182762 16:12061108-12061130 AAGAAGCAGGGCTTGAGGAGGGG - Intronic
1135069602 16:19340425-19340447 TAAAAGGAGGACAGGAGGCCAGG - Intergenic
1135249807 16:20891497-20891519 AAGAGACAGGGATGGAGGCCGGG + Intronic
1135421276 16:22307197-22307219 AAGGATGAGGACTGGAAGCCAGG + Intronic
1135837108 16:25836278-25836300 ATGAAGATGGACTGGGGGCCAGG + Intronic
1135862695 16:26071364-26071386 AAGAAGGAGGACAGGAAGCAAGG + Intronic
1135909486 16:26546082-26546104 AAGAAGCAGAACAGGATGCTGGG + Intergenic
1136475964 16:30513553-30513575 GAGAGACAGGACTGGAGCCCAGG - Intronic
1137546837 16:49410624-49410646 AGGAAGCAGACCTGGAGGCAAGG + Intergenic
1137645193 16:50067124-50067146 AAGGAGGATCACTGGAGGCCAGG + Intronic
1137750528 16:50858209-50858231 AAGGAGAAGCAGTGGAGGCCGGG + Intergenic
1137896042 16:52213922-52213944 AATAACCAGCACTGGAGGCAGGG + Intergenic
1138603127 16:58069404-58069426 AAGAAACAGAACATGAGGCCAGG - Intergenic
1139507503 16:67406479-67406501 AAGAAGCTGGGCTGGAGCCCAGG + Intronic
1139553065 16:67686849-67686871 AGAAAGAAAGACTGGAGGCCGGG + Intronic
1139824713 16:69747860-69747882 AAGAAACAGGAATAGTGGCCAGG + Intronic
1140130456 16:72156321-72156343 AAGAATCAGTATTGGAGGCCGGG + Intronic
1140948316 16:79791978-79792000 TAGATGCAGAAATGGAGGCCTGG - Intergenic
1141004923 16:80343228-80343250 AAGAAAGGAGACTGGAGGCCGGG + Intergenic
1141108788 16:81255076-81255098 AAGAAACAGGACCTGGGGCCAGG - Intronic
1141260439 16:82448805-82448827 GAGAAGCAGGAGTTGAGGTCAGG - Intergenic
1141433129 16:83981156-83981178 CTGAAGCAGCACTGGAGCCCTGG - Intronic
1141463122 16:84190033-84190055 AAGAAGCAGGTGTGGTGGGCTGG - Intergenic
1141715768 16:85725975-85725997 AGGAGGCAGGTATGGAGGCCGGG - Intronic
1141805554 16:86339063-86339085 AGGAAGAATGTCTGGAGGCCTGG - Intergenic
1141982074 16:87556929-87556951 GAGCAGCAGGGCTGGATGCCAGG + Intergenic
1142301663 16:89262249-89262271 ATGAGGCAGGACTGGAGTGCAGG + Intergenic
1142317779 16:89359533-89359555 AAGAATCAAGACTGCAGGGCCGG - Intronic
1142415278 16:89937776-89937798 GAGAAGCAGGGCTGGGGGTCAGG - Intergenic
1142607055 17:1087758-1087780 AAGGAGAAAGCCTGGAGGCCCGG + Intronic
1142626173 17:1193541-1193563 AAGCTTCAGGACTGGTGGCCAGG - Intronic
1142668899 17:1478358-1478380 AGGGAGCAGGACAGGAGACCGGG + Intronic
1142680095 17:1542436-1542458 AAGAAGCAGGAAGGGAGGGAGGG - Intronic
1142717700 17:1755915-1755937 AAGAAGCAAGACTCCATGCCAGG - Intergenic
1143149211 17:4797016-4797038 AATAAGCAATACTGGAGGCCAGG + Intronic
1143202443 17:5122197-5122219 AAACAGCAGGACTGGATGCCTGG + Intronic
1143541561 17:7572564-7572586 AAGAGTCAGGCCTCGAGGCCTGG - Exonic
1143579848 17:7819072-7819094 GGGAGGCAGGACTGGAGGGCCGG - Intronic
1143889251 17:10089870-10089892 TAGAAGTGTGACTGGAGGCCGGG + Intronic
1144224908 17:13135786-13135808 GAGAAGGAGGAGTGGAGCCCAGG + Intergenic
1144543509 17:16169587-16169609 AAAAAGCAGGACTAGAGTCGGGG + Intronic
1144557661 17:16296314-16296336 AGAAAGAAGGACTGGGGGCCAGG + Intronic
1144592699 17:16537926-16537948 AACCAGCAGGACTGTAAGCCAGG - Intergenic
1144596652 17:16575519-16575541 AAGAGGTAGGAGTGTAGGCCAGG - Intergenic
1144626931 17:16848737-16848759 AAACAGCAGGACTGGATGCCTGG - Intergenic
1144657691 17:17047992-17048014 GAGAAGCAGGTCTGGAACCCAGG + Intronic
1144879508 17:18423975-18423997 AAACAGCAGGACTGGATGCCTGG + Intergenic
1144887515 17:18473463-18473485 AAGAACAAGCACTGTAGGCCGGG - Intergenic
1145144702 17:20470832-20470854 AAGAACAAGCACTGTAGGCCGGG + Intergenic
1145152732 17:20520412-20520434 AAACAGCAGGACTGGATGCCTGG - Intergenic
1145300960 17:21636699-21636721 AAAAAGCAGGACTAGAGTCAGGG - Intergenic
1145349339 17:22066576-22066598 AAAAAGCAGGACTAGAGTCAGGG + Intergenic
1145752218 17:27363249-27363271 AAGAGGGTGGAGTGGAGGCCAGG + Intergenic
1145883010 17:28365325-28365347 AAGAAGGGAGGCTGGAGGCCGGG + Intronic
1146164067 17:30574583-30574605 AAACAGCAGGACTGGATGCCTGG - Intergenic
1146533798 17:33632660-33632682 AGGCAGGAGGACTTGAGGCCAGG - Intronic
1146617862 17:34370860-34370882 GAGAAGAAGGCCAGGAGGCCAGG - Intergenic
1146671157 17:34738937-34738959 AAGAAGGAGGAATGGATGCTAGG - Intergenic
1146819332 17:35971984-35972006 AAGATACATGAATGGAGGCCAGG + Intergenic
1147162599 17:38576873-38576895 GAGAAGCGGGACTGGAGGCAGGG - Intronic
1147380014 17:40049111-40049133 AAGAAGGATTACTTGAGGCCAGG + Intronic
1147581069 17:41627426-41627448 AAACAGCGGGACTGGATGCCTGG - Intergenic
1148130140 17:45257373-45257395 AGGGAGCAGGACTGGAGGATAGG - Intronic
1148915029 17:50969330-50969352 GAGAAGCAGGTCTGGAGGGACGG - Intronic
1149033121 17:52105535-52105557 AAGAATAAGGATTTGAGGCCAGG - Intronic
1149563365 17:57625239-57625261 CAGAGGCAGGACTGGAACCCAGG + Intronic
1149784917 17:59426478-59426500 AAGAAAAAGGATTGGAGGTCAGG + Intergenic
1150068490 17:62131958-62131980 AAAAAGTAGGATTGGAGGCTGGG - Intergenic
1150650879 17:67009351-67009373 CAGAAGAGGGACTGGAGGCCAGG - Intronic
1151018688 17:70587025-70587047 AAGAAGCATGACTTTAGGGCAGG - Intergenic
1151542443 17:74771461-74771483 AGGAAGCTGGAATGGAGGGCAGG - Exonic
1151558964 17:74860828-74860850 AAGAAGCGGGACTCGCGGCGGGG + Intronic
1151653260 17:75483166-75483188 GAGGAGCAGGAAAGGAGGCCAGG + Intronic
1151963213 17:77418329-77418351 AAAGAGCAGAGCTGGAGGCCAGG - Intronic
1152099770 17:78294270-78294292 AAGGAACAGGCCTGAAGGCCAGG - Intergenic
1152474961 17:80512084-80512106 AGGCAGCAGGCCTGGATGCCGGG + Intergenic
1152517336 17:80833385-80833407 GAGAAGCAGGGCTGGAGTGCTGG - Intronic
1152663893 17:81556187-81556209 AAGGTGCAGGATTGGAGTCCGGG + Intergenic
1152749565 17:82056430-82056452 CAGGACCAGGACAGGAGGCCAGG - Intronic
1152808445 17:82370018-82370040 TAAAACCAGCACTGGAGGCCAGG + Intergenic
1153021956 18:637279-637301 AAGAACCCAGGCTGGAGGCCAGG - Intronic
1153323681 18:3797036-3797058 AAGAAGAGACACTGGAGGCCAGG + Intronic
1153537026 18:6113196-6113218 AAGAAGATGGACTGGAGTCTTGG + Intronic
1154339523 18:13491746-13491768 AAGACCCAGAACTAGAGGCCAGG + Intronic
1155208181 18:23578529-23578551 CAGAGGCAGGCCTGGGGGCCAGG - Intronic
1155446308 18:25916345-25916367 AAGAAGCAAGACTGGACTCTTGG - Intergenic
1156883338 18:42106261-42106283 AAGAAGCAGGCCTGAGGGCAAGG - Intergenic
1157476853 18:48029212-48029234 AGGGAGAAGGACTGGAGGGCTGG + Exonic
1157701947 18:49766872-49766894 AAGACGCAGGCCTAGAGCCCTGG + Intergenic
1157992991 18:52519892-52519914 AAAAAGATGGACTGGAGGACAGG + Intronic
1158595024 18:58808426-58808448 AAGAAGCAAAACGGTAGGCCGGG - Intergenic
1159056131 18:63465744-63465766 AAAAAAAAAGACTGGAGGCCGGG - Intergenic
1160451627 18:78970311-78970333 CAGAAGGAGCACTCGAGGCCAGG + Intergenic
1160669176 19:348678-348700 AGGAAGCAGGGCTGGAGGGAGGG - Intergenic
1160694695 19:477859-477881 AAGGAGCAGGACGAGAGGACAGG - Intergenic
1160828646 19:1092275-1092297 AAGAAGCATCACCTGAGGCCGGG + Intronic
1160861787 19:1240235-1240257 AAGGAGCGGGGCTGGGGGCCCGG + Intergenic
1161067244 19:2244695-2244717 AACACGCATGACTCGAGGCCGGG - Intronic
1161366769 19:3884426-3884448 GAGAGGCAGGACAGGTGGCCTGG + Intronic
1161371990 19:3917747-3917769 AAGAGGAAAGACTGAAGGCCAGG + Exonic
1161424680 19:4196668-4196690 TAGAAGGAGCCCTGGAGGCCAGG - Intronic
1161431207 19:4233380-4233402 CAGCCGCAGGACTGGAGGACAGG - Intronic
1161795520 19:6384205-6384227 AAAAAACAGGACTGCAGGCCAGG + Intronic
1161946367 19:7439964-7439986 AAGCAGCGGGTCTGGAGGGCAGG - Exonic
1162257471 19:9502503-9502525 AAAAAGTAGAACAGGAGGCCGGG - Intergenic
1162331597 19:10033155-10033177 AAGAAGGAGGGATGGAGGGCGGG + Intergenic
1162990892 19:14301434-14301456 CAGGAGGAGCACTGGAGGCCAGG + Intergenic
1163006254 19:14398372-14398394 AAGAACCTGGAGTTGAGGCCGGG + Intronic
1163054203 19:14706144-14706166 CAGGAGCAGAACTGGAGTCCAGG - Intronic
1163071402 19:14845177-14845199 ATTAAGAAGGAATGGAGGCCAGG + Intergenic
1163198134 19:15740167-15740189 AAGAAGCATAACTTGAGCCCAGG + Intergenic
1163216483 19:15881947-15881969 TAGAAACAGGAGTGGAGGTCGGG + Intronic
1163443553 19:17333849-17333871 AGGAGCCAAGACTGGAGGCCGGG - Intronic
1163484281 19:17576950-17576972 GAGAGGCAGGACTGGGGGCGGGG + Intronic
1163685651 19:18710345-18710367 AGGCAGTAGGACGGGAGGCCAGG - Intronic
1163840748 19:19608055-19608077 AAGAAGTAAAACTGCAGGCCGGG + Intronic
1163844178 19:19629063-19629085 AAGAAGGAGGCCTTGAGGCCGGG + Intergenic
1164107552 19:22122078-22122100 AAAAAGCAAGATTTGAGGCCGGG - Intergenic
1164826422 19:31287874-31287896 AAGCAGGAGGAAAGGAGGCCCGG - Intronic
1165068023 19:33240330-33240352 AGGGAGCTGGCCTGGAGGCCTGG - Intergenic
1165120634 19:33556402-33556424 AAGAAGCAGGGATGGAGGGAAGG + Intergenic
1165380008 19:35472564-35472586 AAGAGGCAGGAATGGAGGGAGGG - Intergenic
1165402221 19:35609030-35609052 AAGAAGCAGAAAGTGAGGCCAGG + Intergenic
1165966297 19:39583896-39583918 CACAATCAGGACTGGAGTCCAGG + Intergenic
1165972004 19:39639668-39639690 CAGAATCAGGACTGGAGTCCAGG + Intergenic
1166044645 19:40222860-40222882 GAGATGGAGGACTCGAGGCCTGG + Exonic
1166390560 19:42406854-42406876 GAGAAGCTGGACTGTGGGCCAGG + Intronic
1166398721 19:42462042-42462064 AAGAAGCAGAATTGTGGGCCAGG + Intergenic
1166805008 19:45481051-45481073 CAGAAGCATCACTTGAGGCCAGG - Intergenic
1167319383 19:48786772-48786794 AAGAAATAGCACTTGAGGCCGGG + Intergenic
1167429434 19:49446145-49446167 AACAAGGGAGACTGGAGGCCAGG + Intergenic
1167618970 19:50551002-50551024 CAGCGGCAGGCCTGGAGGCCGGG - Exonic
1167620166 19:50556160-50556182 AGGAAGCAGGACTAGGGGCTTGG + Intronic
1168070214 19:53945426-53945448 AATCAGCAGGACTGGACTCCCGG + Intergenic
1168146351 19:54421678-54421700 AAGAATCAGGTCTGGGGCCCTGG - Intronic
1168610889 19:57798874-57798896 AAGAAATAGCACTTGAGGCCAGG + Intronic
1202691616 1_KI270712v1_random:98436-98458 AAGGACCAGGACTGGAGTCCAGG + Intergenic
925070730 2:965144-965166 AAGGAGGAGGACTGGGGACCAGG - Intronic
925070758 2:965221-965243 AAGGAGGAGGACTGGGGACCAGG - Intronic
925070772 2:965260-965282 AAGGAGGAGGACTGGGGACCAGG - Intronic
925070786 2:965299-965321 AAGGAGGAGGACTGGGGACCAGG - Intronic
925070814 2:965376-965398 AAGGAGGAGGACTGGGGACCAGG - Intronic
925277015 2:2657344-2657366 AAGAAGCAGCAGTGGAGCCGTGG - Intergenic
925285327 2:2712077-2712099 AAGGAGCAGAGCAGGAGGCCCGG - Intergenic
925577076 2:5370946-5370968 AAGGAGGATCACTGGAGGCCAGG + Intergenic
925850365 2:8075742-8075764 AAGAAGCAGATGTGGAGGCTTGG - Intergenic
926242156 2:11096675-11096697 AACAAGCAGACCTGGAAGCCAGG + Intergenic
926285014 2:11482047-11482069 AGGCAGCAGGAGTGGAGCCCAGG - Intergenic
927251533 2:20998988-20999010 AAGAAGAAAGAATGGAGGCAGGG - Intergenic
927651125 2:24914305-24914327 CAGAAACAGGACGGGAGCCCAGG - Intronic
927651610 2:24916920-24916942 CAGAAACAGGACGGGAGCCCAGG - Intronic
927689818 2:25200627-25200649 GAGAAGCAGGCCTGGAGGTTGGG + Intergenic
927828081 2:26323599-26323621 AAGAAGAAGTAATGGAGGCCAGG - Intronic
929113962 2:38428793-38428815 AAGAAGAAAAACTGGTGGCCGGG - Intergenic
929196568 2:39191101-39191123 CAGAAGCTGGGCTAGAGGCCGGG + Intronic
929278078 2:40046850-40046872 AAAGAGCATGACTGAAGGCCTGG - Intergenic
929408809 2:41673256-41673278 TAGAGGCAGGACTGGATGCCAGG - Intergenic
929564384 2:42975453-42975475 CGAAAGCAGGACTGGAGGGCTGG - Intergenic
929867016 2:45726855-45726877 AAGAAGCAGAACTGAATTCCAGG + Intronic
930080603 2:47444687-47444709 AAAAAGCAGGACTAGAGACCTGG - Intronic
930123406 2:47778174-47778196 CAGAAGGATGACTTGAGGCCAGG - Intronic
930753245 2:54952191-54952213 CAGAAGTAGGGGTGGAGGCCTGG - Intronic
931781448 2:65582344-65582366 AAGAAGCCAGAATGGAGGCTGGG - Intergenic
932420006 2:71596085-71596107 AAAGAGCAGGCCTGGAGGCCTGG - Intronic
932608141 2:73177775-73177797 AAGCAGCAGGACTGGAGCCCAGG + Intergenic
933690481 2:85175742-85175764 AGGAAGAGGGACTGTAGGCCTGG + Intronic
933811899 2:86037864-86037886 ACTATGCAGGAATGGAGGCCCGG - Intronic
933910742 2:86939349-86939371 AAGATGGATCACTGGAGGCCAGG + Intronic
933954772 2:87355514-87355536 AAGGACCAGGACTGGGGTCCAGG - Intergenic
934180632 2:89616420-89616442 AAGAAGCAGAATGGGAGGCAGGG + Intergenic
934238968 2:90251740-90251762 AAGGACCAGGACTGGGGGCCAGG - Intergenic
934274225 2:91564970-91564992 AAGGACCAGGACTGGGGTCCAGG + Intergenic
934290932 2:91690679-91690701 AAGAAGCAGAATGGGAGGCAGGG + Intergenic
934461399 2:94215076-94215098 AAGGACCAGGACTGGGGTCCAGG - Intergenic
935021983 2:99240546-99240568 CAGAAGCAGAACTTGAGGCAAGG - Intronic
935455604 2:103264285-103264307 AACAAGGATGACTGGAGGGCAGG - Intergenic
935805696 2:106745645-106745667 AAAAAGCAGGATTTGAGTCCTGG + Intergenic
936271233 2:111050750-111050772 TAGAAGCAGGCCTGGAGGTGTGG - Intronic
936272391 2:111059010-111059032 AAGAAGGATCACTTGAGGCCAGG + Intronic
936519848 2:113204840-113204862 AAGGAGCAGGACTGGAGGGTCGG + Intronic
936600371 2:113889755-113889777 CAGAAGCAGAACTGGAAGCTCGG + Intergenic
937218402 2:120327284-120327306 CAGAAGCTGGGCTGGAGGCGAGG + Intergenic
937248797 2:120510718-120510740 AGGAAGCTGGCCTGGAAGCCAGG - Intergenic
938483214 2:131679389-131679411 AGCCAGCAGGGCTGGAGGCCTGG + Intergenic
938584319 2:132674195-132674217 AAGAAGCAGGCCCGGGGGCTTGG + Intronic
938668616 2:133565518-133565540 CAGAAGCAGGACTTGAGCCTGGG + Intronic
939820342 2:146949360-146949382 AATAAATAGTACTGGAGGCCAGG - Intergenic
939953650 2:148505843-148505865 TAGAAACAGGACTTGAGTCCAGG - Intronic
940233007 2:151478233-151478255 TAAAAGCATGACTGAAGGCCCGG + Exonic
940384803 2:153058134-153058156 AAAAACCAGGAATGGCGGCCAGG + Intergenic
940865512 2:158813848-158813870 AAGAAAAAGGAAAGGAGGCCGGG - Intronic
940986098 2:160053673-160053695 AAGTTGGGGGACTGGAGGCCTGG - Intronic
941424259 2:165322328-165322350 ATGCAGCAGGACTTGAGGCTCGG - Intronic
941459039 2:165745308-165745330 AAAAAGTAGGACTGTAGGACTGG + Intergenic
941978568 2:171431714-171431736 AAGAAGCAGGGCGGGGGGCCAGG + Intronic
942167120 2:173252848-173252870 AAGAAGCAGCACCAGATGCCTGG - Intronic
942714440 2:178875219-178875241 AAGAAACAGGACTACAGGACTGG + Intronic
944050737 2:195466386-195466408 AAGAAGTATTACTGGAGGCTCGG + Intergenic
944261014 2:197677125-197677147 AAGAAGCAGGATTTGAACCCAGG - Intergenic
944300495 2:198119448-198119470 AAGAAACAGAACTGAGGGCCTGG - Intronic
944908392 2:204285427-204285449 AGGAAGCAGAAGTGGGGGCCTGG + Intergenic
946172270 2:217902530-217902552 GACAAGCAGGACAGGAGACCTGG + Intronic
946202177 2:218076771-218076793 AGGAAGCAGGCCAGGAGGCGGGG - Intronic
946399179 2:219459857-219459879 AGGAAGGAGGGCTGGGGGCCGGG - Intronic
946572585 2:221041080-221041102 AAGAATCAGCACTGGAGGAGGGG - Intergenic
946646288 2:221838348-221838370 AAGGATCAGGACTGGAAGACTGG - Intergenic
946729671 2:222696945-222696967 AAGAAGGAGCACTTGAGCCCAGG + Intronic
947488698 2:230575519-230575541 AAGAAGCAGGAGTGGAGAAATGG - Intergenic
947852045 2:233296216-233296238 CAGAAGGATCACTGGAGGCCAGG + Intergenic
948145538 2:235705444-235705466 AGGAAGCAGGACAGCTGGCCTGG + Intronic
948230608 2:236346463-236346485 CAGAAGCAGGACTGGAGGCCAGG + Intronic
948266863 2:236641308-236641330 GAGACACAGGACTGGATGCCGGG + Intergenic
948315666 2:237026730-237026752 AAGAAGGAGGCCAGGAGGCCAGG + Intergenic
948465108 2:238148502-238148524 GTGAAACAGGACTGGAGACCAGG - Intronic
948681860 2:239640509-239640531 AAGAGGCAGGACCTGTGGCCTGG - Intergenic
948720419 2:239896119-239896141 GACCAGCAGGACTCGAGGCCAGG - Intronic
948899257 2:240947875-240947897 GAGACCCTGGACTGGAGGCCTGG - Intronic
948957145 2:241302328-241302350 AAGCAGAAGGACTTGAGTCCAGG + Intronic
1169479528 20:5965921-5965943 ATGAAGCAGGAATGCAGGTCTGG - Intronic
1170039437 20:12024570-12024592 AAGACATAGGACTGGGGGCCGGG - Intergenic
1170691481 20:18619718-18619740 TAAAAGCAGGAGAGGAGGCCAGG - Intronic
1171036312 20:21715050-21715072 AAGAAGCGGGACTGGAGCAGAGG - Exonic
1171455511 20:25269833-25269855 AGGAAGCAGGTCTCGGGGCCGGG - Intronic
1171559240 20:26107583-26107605 AAAAAGCAGGACTAGAGTCAGGG + Intergenic
1173135023 20:40431949-40431971 AAGAAGCCTTAGTGGAGGCCAGG + Intergenic
1173144334 20:40511639-40511661 CAGCAGGAGGGCTGGAGGCCTGG + Intergenic
1173161980 20:40659572-40659594 CAGAAGCAGGACTGGAAGTGGGG + Intergenic
1173176453 20:40768362-40768384 AAGAACTTGGACTGGATGCCTGG + Intergenic
1173263013 20:41453151-41453173 GACAAGCAGCACTGGGGGCCAGG - Intronic
1173462468 20:43254295-43254317 AAGAGGCAGCACTGGAGGCAGGG - Intergenic
1173659801 20:44725139-44725161 AAGAAAGAGGAGTGGAGGGCCGG + Intronic
1173700768 20:45069500-45069522 AAGAAGCAGGGCTCCAGTCCTGG - Intronic
1174400342 20:50272428-50272450 AAGAACCCAGACTCGAGGCCTGG - Intergenic
1174519597 20:51119318-51119340 CAGAAGCAGGACCGGGAGCCAGG + Intergenic
1174602623 20:51737109-51737131 TAGAAGCAGGAATGGAGCCCAGG + Intronic
1174778087 20:53364062-53364084 AAGAAGGAGGACTGGAGATGAGG + Intronic
1175225213 20:57440614-57440636 CAGCAGCAGGACTCGGGGCCTGG + Intergenic
1175372836 20:58504072-58504094 AAGAAGGAGGAATGGAGCCCAGG + Intronic
1175903847 20:62370373-62370395 AAGAAGGAGGGCTGGAGGCTGGG + Intergenic
1175906004 20:62379763-62379785 CAGAAGTTGGCCTGGAGGCCGGG + Intergenic
1176173329 20:63706303-63706325 AAGAAGTGGCACTGGAGGGCTGG + Intronic
1176174034 20:63709340-63709362 AAGAAGCATGGAAGGAGGCCAGG + Intronic
1176592484 21:8658016-8658038 AAGGACCAGGACTGGGGTCCAGG - Intergenic
1176651712 21:9554495-9554517 AAAAAGCAGGACTAGAGTCAGGG - Intergenic
1176801627 21:13435977-13435999 GAGAAGCAGGGGAGGAGGCCAGG - Intergenic
1176903237 21:14468919-14468941 AAAAGGGAGAACTGGAGGCCCGG + Intergenic
1177139035 21:17339124-17339146 ATGCAGCAGGCCTGGAGGGCAGG - Intergenic
1178071613 21:28974634-28974656 AAGAACCAGGAAAGAAGGCCAGG + Intronic
1178081544 21:29071758-29071780 AAGAAGCAAGAGTGTAAGCCAGG - Intronic
1179025111 21:37673382-37673404 AAGAAACAGGACTGGAAGAGGGG - Intronic
1179547745 21:42124081-42124103 AAGAAGCAGGACCTGGAGCCAGG - Intronic
1179649455 21:42797705-42797727 AAGCAGGAGGACTGGAAGCCAGG - Intergenic
1180275343 22:10635163-10635185 AAGGACCAGGACTGGAGTCCAGG - Intergenic
1180484288 22:15781852-15781874 AACCGGCAGGGCTGGAGGCCTGG + Intergenic
1180824736 22:18854642-18854664 AAGCAGAAGGACAGGTGGCCTGG - Intronic
1181055019 22:20256745-20256767 CTGCAGCAGGCCTGGAGGCCCGG + Intronic
1181125154 22:20697793-20697815 AAGCAGAAGGACAGGTGGCCTGG - Intergenic
1181187994 22:21119905-21119927 AAGCAGAAGGACAGGTGGCCTGG + Intergenic
1181211204 22:21290588-21290610 AAGCAGAAGGACAGGTGGCCTGG - Intergenic
1181398300 22:22636300-22636322 AAGCAGAAGGACAGGTGGCCTGG + Intergenic
1181464320 22:23102575-23102597 AAGCAGCAGGGCTTGAGCCCAGG - Intronic
1181651114 22:24259760-24259782 AAGCAGAAGGACAGGTGGCCTGG - Intergenic
1181706266 22:24650979-24651001 AAGCAGAAGGACAGGTGGCCTGG + Intergenic
1181794205 22:25292430-25292452 AAGAAGCATCACTTCAGGCCAGG - Intergenic
1181864077 22:25841410-25841432 AACAAGCAGGCCTGGAAGCTGGG + Intronic
1181901812 22:26162196-26162218 CAGAAGTAGGACTGGAACCCAGG - Intergenic
1182044320 22:27262492-27262514 AAGAAGCAGGGGTGGGAGCCAGG + Intergenic
1182365398 22:29775500-29775522 TAGAAGCATCACTTGAGGCCAGG - Intergenic
1182648610 22:31831548-31831570 AAGAAGCAGCACTTGAACCCGGG - Intronic
1182713045 22:32334510-32334532 AACCAGCAGGAATGGAGGCAGGG - Intergenic
1183037508 22:35151291-35151313 GAGAAGCGGGCCAGGAGGCCAGG - Intergenic
1183141524 22:35945668-35945690 CCGAGGCAGGACTTGAGGCCAGG - Intronic
1183482414 22:38072385-38072407 GAGAAGCAGGGCAGGGGGCCTGG - Intronic
1183521698 22:38299382-38299404 ATGAGGCAGGAATGTAGGCCGGG + Intronic
1183586420 22:38755657-38755679 AGGAAGCAGGCCTGGCGGCGCGG + Intronic
1183709018 22:39491612-39491634 CAGCAGCAGGAGTGAAGGCCTGG + Exonic
1183930930 22:41235825-41235847 CAGAGCCAGGACTGGAGCCCAGG + Intronic
1184169730 22:42751908-42751930 AAGAAGAAGGGCTTGGGGCCAGG - Intergenic
1184221406 22:43102474-43102496 AAGAAGCCAGACACGAGGCCAGG - Intergenic
1184355343 22:43975799-43975821 AAGTAGCAGGACTGCACCCCAGG - Intronic
1184364292 22:44039905-44039927 CAGAAGGATCACTGGAGGCCAGG - Intronic
1184400306 22:44270075-44270097 AACCAGCAGGAATGGAGGCAGGG - Intronic
1184416045 22:44352487-44352509 AGGAAGCAGGTCTGGCGGGCTGG + Intergenic
1184961789 22:47934806-47934828 AAGAAGCTGGAGCTGAGGCCAGG + Intergenic
1185004741 22:48269058-48269080 AAGAAGGAGGGAGGGAGGCCCGG + Intergenic
1185165436 22:49259333-49259355 CAGAATCAGGACTCGAAGCCTGG - Intergenic
1185288827 22:50014175-50014197 TATAAGGAGGGCTGGAGGCCAGG - Intergenic
1203215745 22_KI270731v1_random:4843-4865 AAGCAGAAGGACAGGTGGCCTGG + Intergenic
1203274882 22_KI270734v1_random:80548-80570 AAGCAGAAGGACAGGTGGCCTGG - Intergenic
949299502 3:2567379-2567401 AAGATTCTGGACTTGAGGCCAGG - Intronic
949415745 3:3812275-3812297 AAGAAGAAGTACACGAGGCCAGG + Intronic
950428475 3:12937510-12937532 GAGAAGCAGGCTTTGAGGCCAGG + Intronic
950475160 3:13210320-13210342 GAGAAGCCGAACTGGAGCCCTGG - Intergenic
950535450 3:13575679-13575701 AAGAGGCAGGACTGGGGGCCAGG + Intronic
950647239 3:14384408-14384430 CAGAGGCAGGACTGGAATCCTGG - Intergenic
950774043 3:15334499-15334521 AAGGAGGATCACTGGAGGCCGGG + Intronic
951377057 3:21931864-21931886 AAGAAGTGTGACTTGAGGCCGGG + Intronic
953098322 3:39801038-39801060 GAGGAGCAGCACTGGAAGCCAGG - Intergenic
953537636 3:43788246-43788268 AAGAAGCAGGGCTGGTTGGCTGG - Intergenic
953608815 3:44430314-44430336 CAGAAGCAACACTTGAGGCCAGG + Intergenic
953672276 3:44973302-44973324 CAGAACCAGGACTTGAGACCAGG - Intronic
953796550 3:45990392-45990414 AAGAAGGAGCACTTGAGGCCTGG + Intronic
954412221 3:50375783-50375805 AGGAGGCAGGGCTGGGGGCCAGG - Intronic
954429711 3:50464031-50464053 AAAAGGCAGGACAGCAGGCCAGG + Intronic
954432406 3:50477894-50477916 AGGAGGCAGGGCAGGAGGCCAGG - Intronic
955032522 3:55234558-55234580 CAGAAGCAGAACCTGAGGCCAGG - Intergenic
956602821 3:71041035-71041057 AAGGAGTAGGCCTGGAAGCCTGG + Intronic
956712456 3:72050449-72050471 GAGAATCAGGAATGGAGCCCAGG + Intergenic
958192206 3:90197456-90197478 AAAAAACAGGACAGGAGGCTGGG - Intergenic
958469055 3:94495639-94495661 AAGAAGCAATACTGCAAGCCAGG - Intergenic
958853243 3:99354132-99354154 GAGACACAGGACTGGAAGCCAGG - Intergenic
959095698 3:101952968-101952990 CAAAAGAAGGGCTGGAGGCCAGG + Intergenic
959644039 3:108677549-108677571 AGGAAGCTGGACTGGAGGCAAGG - Exonic
959873203 3:111351691-111351713 AAGTAGCTGGAGAGGAGGCCAGG + Intronic
960634242 3:119768117-119768139 AGGCAGCAGGACTGGCAGCCCGG + Intergenic
961035267 3:123637696-123637718 AAGAAGGAGGGCAGGAGGCCAGG - Intronic
961171597 3:124801416-124801438 AAGAAGCAGGAGAGGTGGCAGGG - Intronic
961318248 3:126055217-126055239 AAAAAGCAAAACTGCAGGCCAGG + Intronic
961788303 3:129360537-129360559 AAGAGGCCGAACTGGAGCCCTGG + Intergenic
961958672 3:130831046-130831068 AAGATGCAAGAGTGGAGCCCAGG - Intergenic
962027476 3:131563691-131563713 CAGAGGCAGGACTTGAGCCCAGG - Intronic
962086370 3:132196124-132196146 TACAAGCAGGTCTGGAGGCAGGG - Intronic
962423165 3:135246012-135246034 AAGAAGGAGCACTGGAGTCAGGG - Intronic
962880432 3:139571784-139571806 AAGAGGAAGGAGGGGAGGCCAGG + Intronic
963009911 3:140759457-140759479 GAGAAGCAAGACTGGAGGGAAGG + Intergenic
963603007 3:147393393-147393415 AGGGGGAAGGACTGGAGGCCGGG - Intronic
964762799 3:160150533-160150555 AACAAGCAAGACTGAAAGCCTGG + Intergenic
965242498 3:166220664-166220686 GAGAATCAGGTCTGGAGGCAGGG + Intergenic
966564615 3:181362547-181362569 AGGTAGCAGGACTGGAGGCTGGG - Intergenic
967680054 3:192351359-192351381 AAGAACCTGGACTGGAAACCAGG + Intronic
967946889 3:194811208-194811230 AAGGAGAAGGTCTGGAGGCAGGG - Intergenic
968896939 4:3409821-3409843 AAGAACCAGGACGGGAAGACAGG - Intronic
969521503 4:7680432-7680454 AAGAAGCTGGACTCTGGGCCAGG + Intronic
970340417 4:15100522-15100544 AGGAAGCAGGAGTGAAGGACTGG - Intergenic
972297729 4:37756219-37756241 AAGAATTAGAACTGGAGGCTGGG - Intergenic
972601460 4:40576414-40576436 AAGAAATAGGCTTGGAGGCCAGG - Intronic
973566613 4:52194999-52195021 AAGAAGAAGGTATAGAGGCCAGG - Intergenic
973716635 4:53683192-53683214 AATAAGCAAGACTGGAGGTGTGG - Intronic
973979816 4:56298635-56298657 AAGCTGCAGGACTTGGGGCCAGG + Intronic
974983868 4:68994696-68994718 TATAAGCAGGACTCAAGGCCAGG - Intergenic
978923395 4:114214799-114214821 AGGAAGCAGGAATGCAGGACAGG + Intergenic
980411321 4:132423223-132423245 AATAAGCAGAACTGAAGGGCTGG + Intergenic
980853322 4:138410418-138410440 AATGAGAAGGACTGGTGGCCAGG - Intergenic
982052768 4:151518915-151518937 AAGTGGGAGAACTGGAGGCCAGG - Intronic
982246917 4:153362423-153362445 CAGAAGCAGGACTGAAAGCGGGG - Intronic
982566905 4:156997098-156997120 AGGCAGCAGGGCTGTAGGCCTGG + Intergenic
982972946 4:162014030-162014052 AAGGGGCAGGCCTGGAGGTCTGG + Intronic
983027481 4:162755885-162755907 AAGAAGCATGACTGGAAAACTGG + Intergenic
984427833 4:179610543-179610565 AACAAGCAGAACTGTAGGTCTGG + Intergenic
984471241 4:180177086-180177108 AAGAAACAGCAGTTGAGGCCAGG - Intergenic
984527713 4:180876393-180876415 AAGAAGCATGACTGGGGAGCTGG - Intergenic
984665958 4:182430251-182430273 AAAAAGAACGACTGTAGGCCGGG + Intronic
984678335 4:182576953-182576975 AAGAGGCAGGAAAGGAAGCCTGG - Intronic
985486966 5:157340-157362 AAGAAGTGGCTCTGGAGGCCAGG + Intronic
986069616 5:4269315-4269337 TCTCAGCAGGACTGGAGGCCTGG - Intergenic
986075965 5:4338595-4338617 AAGCAGCATTGCTGGAGGCCAGG - Intergenic
986359533 5:6963137-6963159 AAGGAGGATGACTTGAGGCCAGG + Intergenic
987253496 5:16124317-16124339 ACGAGGCAGGACTGGATGACCGG + Intronic
987723841 5:21671756-21671778 AAGAAGGAGGAATGGAGGGAGGG - Intergenic
988365640 5:30294875-30294897 GGGAAGCAGGACTGGAGTCCAGG + Intergenic
988452338 5:31355966-31355988 CACAAGAAGGACTTGAGGCCAGG - Intergenic
988543414 5:32134140-32134162 ATGAAGCACCACTGGAGGCCAGG + Intronic
989000260 5:36752454-36752476 AAGATGTAGGCTTGGAGGCCAGG - Intergenic
989140610 5:38197839-38197861 AACAAAGAGGACTGGAGCCCGGG + Intergenic
989451560 5:41592450-41592472 AAGAAGCAGGTTTGGAGGTAGGG + Intergenic
989613064 5:43313540-43313562 TAGAAGCCGGACTGGGGGGCGGG - Intergenic
990043868 5:51404341-51404363 AAGATGAAAGACTGAAGGCCAGG + Intergenic
990332074 5:54738221-54738243 AGGAAGCAGGACTCTAGACCAGG - Intergenic
991703492 5:69336484-69336506 AAGAGAGAGGACTTGAGGCCGGG + Intergenic
991900269 5:71453647-71453669 AAAATGAAGGTCTGGAGGCCAGG - Intergenic
991943493 5:71877577-71877599 AAGGAGCAAAACTGGAGGGCAGG + Intergenic
992000154 5:72428488-72428510 CAGAACCAGGACTAGAGCCCAGG + Intergenic
992070120 5:73140570-73140592 AAGAAAAATGATTGGAGGCCAGG - Intergenic
992687743 5:79214788-79214810 AAGAAACACAACTGGGGGCCGGG + Intronic
992941805 5:81769874-81769896 CAGAAGGATGACTTGAGGCCAGG + Intergenic
992953971 5:81889266-81889288 AAGAGGCATGACTGCAGCCCAGG + Intergenic
992983687 5:82204578-82204600 AGGGAGCAGGACTGGAAGCAAGG + Intronic
993704897 5:91158683-91158705 TAGAAGCAGGAAGGGTGGCCAGG + Intronic
994719048 5:103359598-103359620 AAGAAGCAGGACTGTATTCAGGG + Intergenic
994797092 5:104317510-104317532 AAGAAATAGCACTTGAGGCCAGG - Intergenic
995221653 5:109655011-109655033 CAGATGCAGGACTGGACTCCAGG - Intergenic
995611148 5:113911696-113911718 AAGAACCAGGACTAGAATCCAGG + Intergenic
995686937 5:114782024-114782046 AAGAAGCAGGAGGAGAGGCATGG - Intergenic
996195357 5:120599748-120599770 AAGACGCTGGGCTAGAGGCCAGG - Intronic
997203940 5:132030451-132030473 ACAGAGCAGGACTGGAGGGCAGG + Intergenic
997649963 5:135509636-135509658 AAGAGGCAGGGCTGGAAGACTGG - Intergenic
998401925 5:141852754-141852776 AAGAAGGGGGCCTGGAGCCCAGG + Intergenic
998520422 5:142795175-142795197 AACAACCAGGACTGGAACCCAGG - Intronic
998817754 5:146031117-146031139 AAGAAGGAGCACTGGATGCCTGG + Intronic
999152045 5:149432830-149432852 AAGAAACAGGACAGGAGCCAAGG - Intergenic
1000110129 5:158100172-158100194 CAGAAGCAGGACTGAAGGGAAGG + Intergenic
1001586852 5:172838657-172838679 AAGGAGGATGACTTGAGGCCAGG - Intronic
1001871264 5:175157941-175157963 AAGAAGCAGGGCTGGATGCCGGG + Intergenic
1001887602 5:175309490-175309512 TGGAAGCAGAACTGGAGACCAGG - Intergenic
1002086454 5:176778814-176778836 AAGAAGCAGCATTGGAGCCGAGG - Intergenic
1002167796 5:177358914-177358936 TAGAACCAGGACTGGAACCCAGG - Intronic
1002880034 6:1242975-1242997 AAGAAGCAGAGCTGGAGGGTGGG + Intergenic
1003071784 6:2950683-2950705 AATGAGAAAGACTGGAGGCCAGG + Intronic
1003235898 6:4294960-4294982 AAGCAGCAGGGCTGCAGGGCTGG - Intergenic
1003571662 6:7260212-7260234 CAGAGGCAGGACTTGAGTCCAGG + Intergenic
1004069234 6:12282550-12282572 AAGGATCAGGCCTGGAGCCCTGG - Intergenic
1004375828 6:15089964-15089986 AAGAAGCAAGACTGGAAAGCTGG - Intergenic
1004411007 6:15381475-15381497 AAGAAAAAAGTCTGGAGGCCAGG - Intronic
1005044585 6:21629568-21629590 AAGAAGAAGCAATGGTGGCCTGG - Intergenic
1006305950 6:33218756-33218778 AGGATCCAGAACTGGAGGCCAGG + Intergenic
1006318913 6:33307695-33307717 AAGAAGCAGAGCTAGAGGCCAGG - Intronic
1007453047 6:41954624-41954646 CAGAAGGATCACTGGAGGCCAGG - Intronic
1007807530 6:44461669-44461691 AAGAAGCAGGACAGCAGCTCGGG + Intergenic
1007946072 6:45828183-45828205 CAGAAGCAGGATTAGAGCCCAGG - Intergenic
1008102370 6:47405701-47405723 AAGGGGCAGGACCAGAGGCCAGG + Intergenic
1009852082 6:69210320-69210342 AAGATGTAGGCCTGGAGGCTAGG + Intronic
1010058943 6:71599581-71599603 AAGAACCAGGACTTGAATCCAGG - Intergenic
1010462753 6:76132184-76132206 GAGATTCAGGAATGGAGGCCAGG + Intergenic
1010524390 6:76882473-76882495 CAGAATCAAAACTGGAGGCCAGG - Intergenic
1010772452 6:79847047-79847069 CAGAAGTATTACTGGAGGCCAGG - Intergenic
1010955726 6:82088807-82088829 GAGAAGCAGCTCTGGATGCCTGG + Intergenic
1012010157 6:93773848-93773870 AAGAATTAGTACTTGAGGCCGGG + Intergenic
1012204670 6:96445718-96445740 TAGGAGGATGACTGGAGGCCAGG - Intergenic
1013100470 6:106982226-106982248 AAGGAGGAGCACTGGAAGCCAGG + Intergenic
1013136704 6:107289393-107289415 AAGAAAAAGAAATGGAGGCCAGG + Intronic
1013357541 6:109359809-109359831 AAGAAACAGGTCTGGAAGGCTGG + Intergenic
1013377516 6:109532226-109532248 AAGAATCAAGACTGAAGGCAGGG - Intronic
1013767780 6:113594576-113594598 AAAAAGGGAGACTGGAGGCCGGG - Intergenic
1014271387 6:119340384-119340406 CAGAAATAGGACAGGAGGCCAGG - Intronic
1014442504 6:121489842-121489864 AAGAATCACCAGTGGAGGCCAGG - Intergenic
1015120924 6:129700836-129700858 AAGAAGCAGGACTTCAACCCAGG + Intronic
1015161382 6:130156041-130156063 AAGAAAAAGGAAAGGAGGCCAGG + Intronic
1015442466 6:133264439-133264461 AGGGAGCAGGACTGGAGGGAAGG + Intronic
1015642564 6:135351506-135351528 AAGAATCAGGACTTGACACCAGG + Intronic
1017591431 6:155982070-155982092 AAGAAACAGAACTGAAGGACGGG + Intergenic
1017786037 6:157757941-157757963 AAGAAGCAGATGGGGAGGCCAGG + Intronic
1017894569 6:158668150-158668172 CAGAAGGAGGCCTGGGGGCCGGG - Intronic
1018160481 6:161037274-161037296 CGGAACCAGGACTGGAGTCCGGG - Intronic
1018192615 6:161323858-161323880 AAGAAGTGGTACTGGCGGCCAGG + Intergenic
1018364097 6:163100349-163100371 AGGCAGCAGGGCTGGAGTCCGGG - Intronic
1018487565 6:164257421-164257443 AAGAAGCAGAGGTGGACGCCGGG + Intergenic
1018666278 6:166141243-166141265 AAAACCCAGGACTGGATGCCAGG - Intergenic
1019073731 6:169370355-169370377 CAGAAGGAGCCCTGGAGGCCCGG - Intergenic
1019670851 7:2277503-2277525 AAGAAACAGGCCTCCAGGCCGGG + Intronic
1019723807 7:2589478-2589500 GAGAGGCAGGAGTGGAGGGCGGG + Intronic
1020259434 7:6522359-6522381 AAGAGGGAGGTCTGGAGGGCAGG + Intronic
1020260337 7:6527224-6527246 AAGCAGGAAGACTGGAGGCGTGG - Intronic
1020954856 7:14728425-14728447 CAGAAGCACAACTGGAGTCCAGG + Intronic
1021092022 7:16495440-16495462 AGGAAGCAGGAGTGGAGGACCGG + Intronic
1021656629 7:22880194-22880216 AGGAAGCAGGAAAGGAGTCCTGG - Intergenic
1021841421 7:24724558-24724580 AAGGAGCAAGTCTGGAGGCAGGG + Intronic
1022166042 7:27763469-27763491 AAGAATCAGACCTTGAGGCCGGG + Intronic
1022667970 7:32428883-32428905 CAGAAGCAGGAAGGGAAGCCTGG + Intergenic
1023135822 7:37050393-37050415 AAGAAATAGAACTGGGGGCCAGG - Intronic
1023250339 7:38253513-38253535 ATGAACCAGGACTGGAACCCTGG - Intergenic
1023251049 7:38261577-38261599 AAAAGACAGGACAGGAGGCCGGG + Intergenic
1023251646 7:38269624-38269646 ATGAACCAGGACTGGAACCCTGG - Intergenic
1024599339 7:50965837-50965859 AATGAGAAGGACTGGATGCCGGG - Intergenic
1024813667 7:53243002-53243024 AAGAAACAAAAGTGGAGGCCGGG - Intergenic
1024848949 7:53686610-53686632 AGGAGACTGGACTGGAGGCCAGG - Intergenic
1025278384 7:57605489-57605511 AAAAAGCAGGACTAGAGTCAGGG - Intergenic
1025900915 7:65744107-65744129 AAGAAACAAGACTGCTGGCCAGG + Intergenic
1025911568 7:65832814-65832836 GAGAAGTAGGAGAGGAGGCCAGG + Intergenic
1026096037 7:67347230-67347252 CAGAAGGAGTACTTGAGGCCAGG + Intergenic
1026254506 7:68698984-68699006 AAGATGTAGGATTGGAGGCTAGG - Intergenic
1026529070 7:71181638-71181660 AAGGAGGATGACTGGAGGCCAGG + Intronic
1026736532 7:72952511-72952533 AAGAGAAAGGAGTGGAGGCCGGG + Intergenic
1026802224 7:73407513-73407535 AAGAAAAAGGAAAGGAGGCCGGG + Intergenic
1026905144 7:74058649-74058671 AACAAGAAGTACTGCAGGCCGGG - Intronic
1026957595 7:74387544-74387566 AAGAAGCAGGGCCAGGGGCCGGG - Intronic
1027107202 7:75412551-75412573 AAGAGAAAGGAGTGGAGGCCGGG - Intergenic
1027439190 7:78199553-78199575 AAGAAGCAAAACTTGAGTCCAGG + Intronic
1028154635 7:87415913-87415935 AAGAAGCAGGATTGAGGGGCAGG + Intronic
1028623164 7:92846634-92846656 AAGAGGGTGGATTGGAGGCCAGG - Intergenic
1029113802 7:98226630-98226652 AAAAGGCAGAAGTGGAGGCCGGG + Intronic
1029416429 7:100446064-100446086 AAGAAGGATCACTTGAGGCCAGG + Intergenic
1029428814 7:100515858-100515880 AAGAGGGAGGTCTGGGGGCCTGG - Intergenic
1029736143 7:102467001-102467023 AAGAAGCATCGCTTGAGGCCAGG - Intronic
1029787886 7:102810810-102810832 CAGAAGGACAACTGGAGGCCAGG - Intergenic
1029792515 7:102859860-102859882 AAGCAGCTGGAGTGGTGGCCTGG + Intronic
1029793704 7:102871918-102871940 AAGGAGAAGGACTGGGGGCAGGG - Intronic
1029863158 7:103597305-103597327 AAGAAAGAGTACTTGAGGCCAGG + Intronic
1032159689 7:129501244-129501266 AAGAAGCAGGAGTAGGGTCCTGG - Intergenic
1032198835 7:129805099-129805121 ATGAAGCAGGCCTGGAGGATGGG + Intergenic
1032413757 7:131720341-131720363 AAGAAGCCTGGCTGGATGCCAGG - Intergenic
1032490100 7:132318123-132318145 AACAAGCAGGCCTGCAGGCAGGG + Intronic
1032757571 7:134905655-134905677 GAGGAGCAGGGCTGGAGGGCTGG + Intronic
1032818850 7:135505257-135505279 AAGAAGCCGTACTTGAGGCCGGG + Intronic
1034094327 7:148392640-148392662 CAGAAGCAGGAGTGGAGGGAAGG + Intronic
1034271383 7:149804893-149804915 GAGAAGTGGGGCTGGAGGCCAGG + Intergenic
1034625632 7:152490177-152490199 AAGGAGGATGACTTGAGGCCAGG + Intergenic
1034754167 7:153598940-153598962 TAGAAGCAGGGCTGGAGACAAGG - Intergenic
1035297043 7:157873159-157873181 AGGAAGCAGGACTTCAGGGCAGG - Intronic
1035741350 8:1930549-1930571 AGGAACAAGGACTGGAGGACTGG - Intronic
1035777343 8:2198421-2198443 AAGAAACAGGGCTGGGCGCCGGG - Intergenic
1035816676 8:2548694-2548716 AAGAAGTAGGAATGGAGGTCAGG - Intergenic
1037737309 8:21578081-21578103 AAGAATCAGCACTGGGGGCCAGG + Intergenic
1037767879 8:21782956-21782978 AAGATGCAGGCCTGGGGGCTTGG + Intronic
1037949241 8:23007962-23007984 AAGAAGCATCACAGGAGGACTGG - Intronic
1038660703 8:29494139-29494161 AGGAGGCAGGGCTGGAGGCCTGG + Intergenic
1038768248 8:30450579-30450601 AAGAAGTGGAACTGAAGGCCTGG - Intronic
1039046844 8:33458417-33458439 TAAAAACAGGAATGGAGGCCAGG + Intronic
1039363115 8:36901740-36901762 AAGAAGCAAGACTTGTGACCAGG + Intronic
1039445049 8:37624283-37624305 AAGAACCAGGGGTGTAGGCCAGG + Intergenic
1039475768 8:37838740-37838762 GCAAAGCAGGACTGGAGGCAGGG + Intronic
1039704290 8:39991051-39991073 AAGAAGCAGGACTGGAGGGAGGG + Intronic
1039906045 8:41787124-41787146 GGGAAGCTGGACTGGAGGGCAGG + Intronic
1040568008 8:48583710-48583732 CTGAAGCAGGACAAGAGGCCAGG - Intergenic
1040818158 8:51530398-51530420 AAGGAGGAAGACTAGAGGCCAGG - Intronic
1041192857 8:55370890-55370912 TAGAAGCAAGAATGGACGCCTGG + Intronic
1041196326 8:55405237-55405259 AAGAATCAGGCCTGGCAGCCTGG + Intronic
1041324951 8:56653811-56653833 AAGAAGGGCGACTTGAGGCCCGG - Intergenic
1042059223 8:64798929-64798951 AAGAACCAGCCCTGAAGGCCTGG + Intergenic
1042986075 8:74584360-74584382 TAGAAGGATGACTTGAGGCCAGG + Intergenic
1044791302 8:95849777-95849799 GAGAAGCAGGAATGAAGGCAAGG + Intergenic
1044815406 8:96107667-96107689 AAGAAGAAGGTCTGGCTGCCTGG + Intergenic
1044865412 8:96565948-96565970 AAGAAGCAAGACTCAAGCCCAGG - Intronic
1045064835 8:98435786-98435808 CAGAGGGAGGCCTGGAGGCCAGG + Intronic
1045325141 8:101112359-101112381 CAGCAGCAGGAGCGGAGGCCAGG + Intergenic
1045390320 8:101708722-101708744 CAGAATCATGACTGGAAGCCAGG + Intronic
1045468185 8:102488358-102488380 GAGCAGAGGGACTGGAGGCCAGG + Intergenic
1045647865 8:104317008-104317030 AAGAGCCAGGCCTGGAGGTCAGG - Intergenic
1045928781 8:107600222-107600244 AAGTGGCAGGACTGGAATCCTGG - Intergenic
1046020527 8:108659471-108659493 AAGGACCAAGACTGGAAGCCAGG - Intronic
1046624560 8:116562864-116562886 CAGAAGCATCTCTGGAGGCCTGG + Intergenic
1046873657 8:119230053-119230075 AATAAGCAGTTCTGGATGCCTGG + Intronic
1046938511 8:119908359-119908381 CAGAAGCATGGCTTGAGGCCAGG + Intronic
1047635298 8:126755313-126755335 AAGAATCAGAACTGGAGGAGAGG - Intergenic
1047731407 8:127731883-127731905 AAGAAGAAGGAGAGGAGGCTGGG + Intergenic
1047773303 8:128048385-128048407 AAGGAAAAGGACGGGAGGCCAGG - Intergenic
1047903695 8:129450434-129450456 ATAAAGCAGGACTAGAAGCCAGG + Intergenic
1048336185 8:133504147-133504169 ATGATGCAGGACTGGAGGAGGGG - Intronic
1048451503 8:134537692-134537714 AAGGAACAAGACTGGAGGCAGGG + Intronic
1048602313 8:135931218-135931240 AAGGGGCAGGACAGGAGGTCAGG + Intergenic
1049190466 8:141284765-141284787 ATGAAGAAGGACTGAAGGGCAGG + Intronic
1049209165 8:141377369-141377391 CAGAGGCTGGACTGGTGGCCAGG - Intergenic
1049306355 8:141906355-141906377 AGGAGCCAGGACTGGAAGCCAGG + Intergenic
1049362665 8:142219704-142219726 GGGAGGCAGGACTGGATGCCCGG + Intronic
1049589623 8:143451190-143451212 AGGAAGCAGGACAGGAGCCCGGG + Intronic
1049697035 8:143989281-143989303 ATGCAGCAGGACTGGAGGCCAGG - Intronic
1049838686 8:144755958-144755980 AAGAACTGAGACTGGAGGCCTGG - Intronic
1049958892 9:719260-719282 AAGAAAAAGGGCTTGAGGCCGGG - Intronic
1050338430 9:4612267-4612289 AACAACCAGGATTGGAGGCTGGG - Intronic
1051278900 9:15422390-15422412 AAGAACCAGATCTGGAGGGCTGG + Intergenic
1051588010 9:18747553-18747575 AACAAGCAGGAGCTGAGGCCTGG - Intronic
1051809877 9:21036780-21036802 ATGAAGAACGAATGGAGGCCTGG - Intergenic
1051866417 9:21688094-21688116 AATAGGAAGCACTGGAGGCCGGG - Intergenic
1053268969 9:36736935-36736957 AAGACGGAGGACTGGAGGCTTGG + Intergenic
1053269642 9:36741056-36741078 AAGAAACAGGACCTGAGCCCCGG + Intergenic
1053335023 9:37260359-37260381 AAGCAGCTGGACTGGCTGCCTGG - Intronic
1054841856 9:69750672-69750694 AAGAAGCAGAACTAGAATCCAGG + Intronic
1055656299 9:78453186-78453208 AAGAATCAGAACTGGAGTCAGGG + Intergenic
1055947399 9:81703860-81703882 AAAAAACAGCACTAGAGGCCGGG + Intergenic
1056250870 9:84746707-84746729 AAAGAGCAGGACTGGAGCACTGG - Intronic
1056353782 9:85777729-85777751 AAGAAGCATGATTGGAAGACTGG - Intergenic
1056499153 9:87190705-87190727 TAGAAGCAGGCCAGGAGTCCAGG + Intergenic
1056947161 9:91007902-91007924 AAGAATCAGAAATGGAGGTCAGG + Intergenic
1057198448 9:93127833-93127855 AAGATGCAGGCCGGGAGGCCGGG + Intronic
1057319278 9:93997423-93997445 AAGGAACAGGACTGGAGGATTGG - Intergenic
1057774905 9:97999781-97999803 CAGAGGCAGGACTGGAGGCAGGG + Intronic
1057848602 9:98545745-98545767 TAGAAGCAGGACTTGAACCCGGG + Intronic
1057910641 9:99017403-99017425 AAGATCCTGGACTGGGGGCCAGG + Intronic
1058437921 9:104980746-104980768 AAGAAGCAGAACCTGAAGCCAGG - Intergenic
1058757551 9:108097394-108097416 AAGTGGAAGGACTGGAGCCCAGG + Intergenic
1058767340 9:108194634-108194656 AGGAGGCAGGACTGGAGGCAGGG - Intergenic
1058941959 9:109821751-109821773 AGGAAGCAGGGCTGGAGCCTTGG - Intronic
1059388182 9:113981484-113981506 CAGAAATAGGACTGAAGGCCAGG + Intronic
1060256326 9:122034432-122034454 AAGAAGCACCCCTGGAAGCCAGG + Intronic
1060386685 9:123236836-123236858 AAGAAGCAACAGTTGAGGCCAGG + Intronic
1060512522 9:124244260-124244282 CAGAGTCAGGACTCGAGGCCAGG - Intergenic
1060526356 9:124323452-124323474 TAGAAGAAAGACTGGAGGCCGGG + Intronic
1060530539 9:124344927-124344949 CAGAAGGGTGACTGGAGGCCAGG - Intronic
1060966237 9:127713800-127713822 AAGATGCTGGCTTGGAGGCCGGG - Exonic
1061278128 9:129581321-129581343 AGGGAGCAGGACTACAGGCCTGG - Intergenic
1061629520 9:131863343-131863365 AGGATGCAGGCCTGGAGGCAGGG + Intronic
1061675449 9:132213021-132213043 GAAAAGAAGGACTTGAGGCCGGG + Intronic
1061836431 9:133332833-133332855 AAGAATCAGGGCTGGAAGGCAGG + Intronic
1061935001 9:133852652-133852674 GAGAAGCAGGGCTGGCAGCCTGG - Intronic
1062373382 9:136251766-136251788 AAGAAGCAGGTGTGCAGTCCGGG + Intergenic
1062396812 9:136355901-136355923 TGGAAGCAGGACGGGAGCCCTGG - Intronic
1062421897 9:136486650-136486672 AGGAAGCAGATCTGGAGGCAGGG + Intergenic
1203622538 Un_KI270749v1:136849-136871 AAGGACCAGGACTGGGGTCCAGG - Intergenic
1203629443 Un_KI270750v1:58050-58072 AAAAAGCAGGACTAGAGTCAGGG - Intergenic
1185732205 X:2470332-2470354 AAGGAGGATCACTGGAGGCCAGG + Intronic
1186830279 X:13383295-13383317 GAGAAGGAGGAGAGGAGGCCTGG + Intergenic
1187115721 X:16348270-16348292 GAGAAGGAGGTCTGGGGGCCTGG + Intergenic
1188283033 X:28293934-28293956 AAGAAGCAGGACTGGAAACGAGG - Intergenic
1189180115 X:38996013-38996035 GAGAGGCAAGACTGGAGGCAGGG + Intergenic
1189428142 X:40920868-40920890 GAGAAACAGGAATGGAGGCTGGG - Intergenic
1189698086 X:43686501-43686523 AAGAAACAGGCATGGAGGCCGGG + Intronic
1190211737 X:48454142-48454164 AAGGAGGATGACTTGAGGCCAGG - Intergenic
1190360563 X:49644937-49644959 GGTCAGCAGGACTGGAGGCCTGG + Intergenic
1190470246 X:50771223-50771245 GAGAACCAAGACTGAAGGCCTGG - Intronic
1191942944 X:66499655-66499677 AAGAAGGAGGAATGCAGGACTGG + Intergenic
1192047144 X:67687573-67687595 AAGAAGTAGGACTGGGGTCAGGG + Intronic
1192814291 X:74575035-74575057 AAGAAGGATCACTTGAGGCCAGG - Intergenic
1192882252 X:75298217-75298239 CAGGAGCATCACTGGAGGCCAGG - Intronic
1194496152 X:94620142-94620164 AAGAAGCAAAAGTGGAGGCCGGG + Intergenic
1195135858 X:101906741-101906763 CAGAAGCAAGCCTGGAGGCTGGG - Intronic
1195396398 X:104415049-104415071 AAAAAGCAGCAGTAGAGGCCGGG + Intergenic
1196310206 X:114155305-114155327 AAGAAAGAGGACTGGAAGCCTGG + Intergenic
1196761603 X:119205716-119205738 AAGAAGCAGAAATAGAGGCAGGG + Intergenic
1197530352 X:127616626-127616648 GAGAAGCAGAACTGGTGGGCAGG - Intergenic
1198006497 X:132499865-132499887 AGGAGGCAGGACTTGAGCCCAGG + Intergenic
1198370238 X:135982911-135982933 AAGAAGCAAGGCTGGATTCCTGG + Intergenic
1199010619 X:142754155-142754177 ATGGAGCAGGCCTGGAGGCACGG + Intergenic
1199290567 X:146100573-146100595 AAAAAGCAGGTCATGAGGCCGGG - Intergenic
1201281019 Y:12342009-12342031 AATAAGAAAAACTGGAGGCCAGG - Intergenic
1201332571 Y:12841463-12841485 AGGTGGCAGGACTTGAGGCCAGG + Intronic
1201716422 Y:17048953-17048975 AAGAAACCTGAATGGAGGCCAGG + Intergenic