ID: 1125530791

View in Genome Browser
Species Human (GRCh38)
Location 15:40412227-40412249
Sequence GGCAGAACACAATGGTGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125530791 Original CRISPR GGCAGAACACAATGGTGAGC TGG Intronic
900118422 1:1038449-1038471 GGCAGCTCACCAGGGTGAGCGGG - Intronic
900136600 1:1120327-1120349 CACAGATCACAGTGGTGAGCAGG + Intergenic
900775506 1:4581706-4581728 GGGAGAACACAATACTGAACAGG - Intergenic
901259734 1:7862583-7862605 GGCAGAAGGCAAGGGGGAGCTGG + Intergenic
901931630 1:12599601-12599623 GCCAGAACAAAAGTGTGAGCAGG - Intronic
902007860 1:13246392-13246414 GGCAGAACCCAAGGGGGAGCGGG + Intergenic
902026839 1:13390187-13390209 GGCAGAATCCAAGGGGGAGCGGG + Intronic
902944645 1:19826041-19826063 GGGAGAAAGCAACGGTGAGCTGG - Intergenic
903719033 1:25390740-25390762 GGAAGATCAGCATGGTGAGCAGG - Exonic
903728998 1:25475662-25475684 TGCGGAACAGAATGGGGAGCAGG + Intronic
905560452 1:38922727-38922749 GGCAGAAGATAAACGTGAGCGGG - Intronic
905972309 1:42151359-42151381 GGCTGAACTCAATGCTGGGCTGG - Intergenic
906085589 1:43130943-43130965 GGCAGAAAGCAAGGGAGAGCAGG - Intergenic
906749615 1:48247299-48247321 GCCAGAAGACAAAGGAGAGCAGG - Intronic
907109358 1:51912691-51912713 GGCAGAAAACAATGGTGGCCTGG + Exonic
909020466 1:70425663-70425685 GGCAGAAGGCAAAGGGGAGCAGG + Intronic
910675232 1:89809550-89809572 GACTGAACACCATGGTTAGCTGG + Intronic
911966815 1:104381592-104381614 TGCAGAACAAAATTGTAAGCCGG - Intergenic
913052156 1:115126888-115126910 GCAGGAAGACAATGGTGAGCTGG + Intergenic
913179918 1:116311445-116311467 GGAAGAGCAGACTGGTGAGCTGG - Intergenic
916064403 1:161124405-161124427 GCCAGAAGAGCATGGTGAGCAGG - Exonic
916785440 1:168083811-168083833 GGCAGAAACCAATGGTTAGCTGG - Exonic
918361135 1:183759218-183759240 GGCAGAAGACAAGAGTGAGTGGG + Intronic
919421428 1:197374450-197374472 GGCAGAGCACAATGGCATGCAGG - Intronic
923660152 1:235950606-235950628 GGCAGAAACCAGTGGGGAGCCGG + Intergenic
923848350 1:237763386-237763408 GGCAGAGCACACTGGCGAGGAGG - Intronic
924041725 1:239990574-239990596 GGAAGAAGACAGTGGTGAGTGGG - Intergenic
1063661966 10:8040960-8040982 GCCATAAAACACTGGTGAGCAGG + Intergenic
1064184278 10:13147222-13147244 GGCAGAAGGCAAAGGGGAGCAGG + Intergenic
1066005593 10:31143714-31143736 GGCAGAAGAGAAAGGGGAGCTGG - Intergenic
1067753908 10:48989606-48989628 TGCAGAACACACTGACGAGCTGG - Intergenic
1067920785 10:50455069-50455091 ACTAGAACACAATAGTGAGCAGG - Intronic
1070764553 10:79048853-79048875 GTCAGGACACAATGCTGAGTTGG + Intergenic
1071781110 10:88845860-88845882 TGCAAAACACAATGGAAAGCGGG - Intronic
1072568638 10:96639642-96639664 GACAGAACCCACTGGGGAGCAGG - Intronic
1075785172 10:125044392-125044414 GGCAGAAGTCATTGGTGGGCTGG - Intronic
1076189027 10:128469954-128469976 GGCAGAAAAGAAAGGGGAGCAGG - Intergenic
1077869070 11:6246341-6246363 GGCAGAGCAAAATGGATAGCTGG - Intergenic
1079391210 11:20023539-20023561 GGCAGTACAGAGGGGTGAGCCGG + Intronic
1079580365 11:22055983-22056005 GGCAGGCCAAAATGGTGAACTGG + Intergenic
1079983609 11:27177607-27177629 GGCAGAAAACAATGGGGGACAGG - Intergenic
1084504557 11:69557153-69557175 GGCAGAAGGCAATGGGAAGCTGG + Intergenic
1084955058 11:72686746-72686768 GGTAGAACCCAGAGGTGAGCAGG - Intronic
1086580946 11:88397619-88397641 GGCAGAAGGCAAAGGAGAGCAGG - Intergenic
1090455247 11:126843463-126843485 GGCAGATCACAATTGAAAGCAGG - Intronic
1090849583 11:130560558-130560580 GCCAGAAAAGAATGGGGAGCAGG - Intergenic
1091723591 12:2830629-2830651 GGCAGAGCAGAAAGGAGAGCAGG + Intronic
1091985371 12:4906796-4906818 TGGACAAGACAATGGTGAGCTGG + Intergenic
1093306673 12:17528668-17528690 GGCAAAAGACAAAGGGGAGCTGG - Intergenic
1094490390 12:30957238-30957260 GGCAGAAGACCATGGTGTGGGGG - Intronic
1095625357 12:44307848-44307870 GGCAGAAGGTAATAGTGAGCTGG + Intronic
1095987768 12:48010879-48010901 TGCAGAACACAATGGGGCCCTGG - Intergenic
1096022521 12:48333963-48333985 GGCAGAAGATAAACGTGAGCGGG + Intergenic
1097133112 12:56828260-56828282 GGCAGCACACAAAGGTGCCCTGG - Intergenic
1099429535 12:82565577-82565599 GTCAGCACACAATGGTGGGCAGG + Intergenic
1100067671 12:90669708-90669730 GGCAGAAGGCAAAGGGGAGCTGG - Intergenic
1104566329 12:129887925-129887947 GGCAGAACTCATTTGTAAGCTGG + Intronic
1106229050 13:27807779-27807801 GCCAGATCCCTATGGTGAGCTGG - Intergenic
1106803176 13:33277821-33277843 GGCAGAACAGAAAGCTGAGTCGG - Intronic
1108898012 13:55359515-55359537 GGCAGAAAGCAAAGGGGAGCTGG - Intergenic
1109132427 13:58603981-58604003 TGCAGAACACATTGGTGTGTGGG + Intergenic
1110360713 13:74621604-74621626 GGCAGAAGGCAAAGGGGAGCAGG - Intergenic
1114948829 14:27720612-27720634 GGCAGAAGATGATGGGGAGCTGG - Intergenic
1117450504 14:55845306-55845328 GGCGGAACACACAGGTGAGTAGG + Intergenic
1118076876 14:62309093-62309115 GGCAGAACTCAATGGAGAAGGGG - Intergenic
1119386607 14:74261265-74261287 GGCAGAGCAGAATGTAGAGCTGG - Exonic
1119514948 14:75240679-75240701 GGCTGATCACCATGGTGAGATGG - Intronic
1121618042 14:95326842-95326864 GAAAGAATACAAGGGTGAGCTGG + Intergenic
1122325874 14:100880406-100880428 GGGAGAAAGCAGTGGTGAGCAGG - Intergenic
1123161680 14:106284611-106284633 GGCAGAAGACAAAGGGGAGCAGG - Intergenic
1123177413 14:106434065-106434087 GGCAGAAGACAAAGAGGAGCAGG - Intergenic
1123213957 14:106788780-106788802 GGCAGAAGACAAAGGGGAGCAGG - Intergenic
1123400861 15:19984316-19984338 GGCAGAAGACAAAGGGGAGCAGG - Intergenic
1125530791 15:40412227-40412249 GGCAGAACACAATGGTGAGCTGG + Intronic
1127241325 15:57118152-57118174 GAAAGAACACAATGGTGACAAGG - Intronic
1127604042 15:60568234-60568256 GGCAGAACAGAAAGGTGCACAGG - Intronic
1128218700 15:65952551-65952573 GACAGAACACCAGGGTGAACAGG - Intronic
1131785314 15:95905961-95905983 GGTGGAACACAAAGGGGAGCAGG - Intergenic
1132119998 15:99168318-99168340 GGCAGATCCCAATGGCGACCAGG - Intronic
1132665413 16:1079234-1079256 GGCAGAAGACACTGGTGAACTGG - Exonic
1133784943 16:8966136-8966158 GCCAGACCACAGAGGTGAGCAGG + Intergenic
1135280310 16:21148637-21148659 TGCAGAACACAATGGAAAGAGGG + Intronic
1139294045 16:65884569-65884591 TGCTGAACACATTGGTAAGCTGG + Intergenic
1139357129 16:66373041-66373063 GCCTGATCACAGTGGTGAGCAGG - Intronic
1143566118 17:7721823-7721845 GGCAGAACTGAATGCTCAGCAGG + Intronic
1144057206 17:11553976-11553998 GGCAGAAGGCAAGGGAGAGCTGG + Intronic
1145788004 17:27606559-27606581 GGCTGAACCCAGTGGTGTGCTGG + Intronic
1146373044 17:32277056-32277078 GGGAGAAGACAATGGGGATCCGG + Intronic
1146499029 17:33348573-33348595 GGCACAACACCAGGGTGAGAGGG + Intronic
1146508885 17:33428769-33428791 GACAGAAAACAATGGTGGGTGGG - Intronic
1148977891 17:51545536-51545558 GGCAGAAGGCAAAGGGGAGCAGG - Intergenic
1155116510 18:22773603-22773625 GGCAGAAGACAAAGGGGAGTGGG - Intergenic
1159926919 18:74277801-74277823 GGCAGAACACAACGGTGTCATGG + Intronic
1160530235 18:79558329-79558351 GGCAGAGGACAGTGGTGAGGAGG - Intergenic
1161467898 19:4442360-4442382 AGCAGAACGCACTGGTGAGGTGG + Intronic
1161932206 19:7348651-7348673 GGCGGAACAACATGGTGTGCTGG - Intergenic
1162024740 19:7887603-7887625 GGCAGACCACAGTGTTGGGCAGG + Intergenic
1168557269 19:57353533-57353555 GGCTGGACACAGTGGTGAGAGGG + Intronic
925994323 2:9279507-9279529 TGCAGATCACAGAGGTGAGCTGG + Intronic
927826106 2:26311273-26311295 AGCAGAACACCATGTTGAGCAGG + Exonic
932087165 2:68772677-68772699 GGCAGAATACAATGGGGAGGAGG - Intronic
933985085 2:87584238-87584260 GTCACAACACAACGCTGAGCCGG + Intergenic
935471437 2:103465166-103465188 GGCAGAAGGCAAAGGTGAGCTGG - Intergenic
935873929 2:107485742-107485764 GGCAGAAGGCAAAGGGGAGCTGG - Intergenic
936308759 2:111366573-111366595 GTCACAACACAACGCTGAGCCGG - Intergenic
937339415 2:121081595-121081617 GACAGATGTCAATGGTGAGCTGG + Intergenic
938397304 2:130961125-130961147 GGCTGGACCCAATGGTCAGCTGG - Intronic
938606147 2:132894797-132894819 GGCAGAAGAAATTGGGGAGCAGG - Intronic
941683678 2:168426301-168426323 GGCAGATCACAGGGGAGAGCAGG - Intergenic
942432241 2:175924806-175924828 GGCAGAAAGCAAAGGGGAGCTGG + Exonic
943769569 2:191701899-191701921 GGCAGAAAACAAAGGGGAGCTGG - Intergenic
943907239 2:193515137-193515159 GGCAGAAAACGATGGGGAGCTGG + Intergenic
944802500 2:203250003-203250025 GGCAGAACACACTGTTGATGAGG + Intronic
947136793 2:226983928-226983950 GGCAAAACGCAATGGTGTGGGGG + Intronic
1170988413 20:21279775-21279797 GGCAGAAGGCAAAGGGGAGCTGG + Intergenic
1171272292 20:23826531-23826553 TGCAGACCTCAATGATGAGCGGG - Exonic
1173257593 20:41405787-41405809 GGCAGAAGAGAGTGGGGAGCTGG + Intronic
1173891991 20:46519955-46519977 GAAAGAACTCAAAGGTGAGCTGG - Intergenic
1174580029 20:51564720-51564742 TGCAGAAGACAATGGTTAGCAGG - Intergenic
1174916474 20:54659386-54659408 GGCAGAAGGCAATGCAGAGCGGG - Intergenic
1175948683 20:62570788-62570810 CCCAGAACACACTGGGGAGCTGG - Intergenic
1180115784 21:45704122-45704144 GGAAGAACAAACTGGTCAGCTGG + Intronic
1182206234 22:28630138-28630160 GGCAGAAGGCAAAGGGGAGCTGG - Intronic
1183217460 22:36490146-36490168 GGCAGCACAGAGTGGAGAGCAGG - Exonic
1183256617 22:36766496-36766518 GGCAGAACAGAATGCTAAACAGG + Intronic
1183280121 22:36927548-36927570 CCCTGGACACAATGGTGAGCAGG - Intronic
1183426131 22:37740409-37740431 GGCAGGTAACAATGGTGAGAAGG + Intronic
953065013 3:39460822-39460844 GCCAGAACACAATTGTGACTGGG + Intergenic
953610428 3:44443173-44443195 GGCAGAACACTCTGGGGGGCTGG + Exonic
954132502 3:48567709-48567731 GGCAGGACACAAAGGAGAGATGG - Exonic
954425182 3:50439468-50439490 GGCAAAACCCCAAGGTGAGCTGG - Intronic
954877797 3:53814433-53814455 GGCAGGAGACAATGAGGAGCAGG + Exonic
956001348 3:64733266-64733288 GTCAGCAAACTATGGTGAGCTGG - Intergenic
956482779 3:69689527-69689549 GGCAGAAGGCAAAGGAGAGCTGG + Intergenic
957824448 3:85422784-85422806 GAGAGAACACACAGGTGAGCAGG + Intronic
962771196 3:138611801-138611823 GGCAGAAGGCAAAGGAGAGCTGG - Intronic
967137140 3:186522014-186522036 GGGAGAACAGAACGGAGAGCTGG - Intergenic
968004884 3:195236048-195236070 GGCAAAACTCAGTGGTGTGCTGG - Intronic
968448946 4:666195-666217 GGCTGTACACAGTGCTGAGCCGG - Intronic
970651183 4:18179710-18179732 CCCAGAATACAAAGGTGAGCTGG - Intergenic
971068440 4:23062054-23062076 GGCACAAAACAATGATGAGGGGG - Intergenic
971911056 4:32798413-32798435 GAAAGAAGACAAGGGTGAGCTGG - Intergenic
976028346 4:80719765-80719787 GGCTGGACAAGATGGTGAGCTGG - Intronic
979919368 4:126478847-126478869 GGGGGAACACACGGGTGAGCAGG - Intergenic
981692432 4:147524229-147524251 GGCAGAACAAAAAAGTGAGGAGG - Intronic
982401303 4:154970938-154970960 GTCAGACCACAAAGGTGACCCGG - Intergenic
985269958 4:188184325-188184347 GGGAGAGCACACAGGTGAGCTGG - Intergenic
985705593 5:1399846-1399868 GGCAGAACAAGACGCTGAGCAGG - Intronic
985888721 5:2699720-2699742 GGCAGAGCCCAAAGGAGAGCCGG - Intergenic
985895783 5:2749373-2749395 GGCAGAGGACGAAGGTGAGCGGG - Exonic
986502518 5:8415493-8415515 TGCAGAACAAAATTGTAAGCCGG - Intergenic
986614614 5:9603585-9603607 GGTATAACCCAATGGTGAGTCGG + Intergenic
987278602 5:16389128-16389150 GGCAGAAGGCAAAGGGGAGCAGG + Intergenic
989005019 5:36800634-36800656 GGCAGAAGGCAAAGGAGAGCCGG - Intergenic
990384390 5:55245478-55245500 GGCAGAAGGCAAAGGGGAGCAGG - Intergenic
993268569 5:85762597-85762619 GGCAGCCCACGATGGTGACCAGG - Intergenic
993552746 5:89294916-89294938 GGCAGAAGAGACTGTTGAGCAGG + Intergenic
994506604 5:100650345-100650367 GGCTAAACACAGTGGTGTGCTGG - Intergenic
995357490 5:111255811-111255833 GGTATAAAACAGTGGTGAGCAGG - Intronic
997587011 5:135049199-135049221 GGCAAAACAGAAGTGTGAGCAGG - Intronic
998624427 5:143829435-143829457 GGAAGAACTCAATGGTCACCGGG - Intergenic
999990910 5:157049045-157049067 GTAAGAGTACAATGGTGAGCTGG + Exonic
1001578883 5:172784788-172784810 GGCAGAAGGCAAGGGGGAGCAGG - Intergenic
1001616589 5:173047901-173047923 GGGAGAGCACACAGGTGAGCGGG - Intergenic
1004726788 6:18318655-18318677 TGCAGAAAAAAATGGTGAGTGGG + Intergenic
1005849068 6:29805390-29805412 GGCAGAAGGCAAAGGGGAGCTGG - Intergenic
1005860891 6:29899306-29899328 GGCAGAAGACAAAGGTGAGCTGG - Intergenic
1005869147 6:29960604-29960626 GGCAGAAGGCAAAGGGGAGCTGG - Intergenic
1006188280 6:32192471-32192493 GGAAGAAGAGGATGGTGAGCAGG - Exonic
1009379078 6:63007051-63007073 GGCAGAACAAAACTGTAAGCTGG - Intergenic
1013418214 6:109943523-109943545 GGCAGAAGACAAGGGTGGGTTGG - Intergenic
1013827469 6:114231333-114231355 GGCAGAAGGCAAAGGGGAGCAGG - Intronic
1014550684 6:122786958-122786980 GCCAGAAAAAACTGGTGAGCTGG - Intergenic
1017074910 6:150609080-150609102 GGCAAAAGTCAATGGTGAGAGGG + Intronic
1018195266 6:161350220-161350242 GGCAGAAAACAAAGGTGTGGTGG + Intronic
1018556253 6:165053290-165053312 GGCAGAGCAGAATGCTGTGCTGG - Intergenic
1018766377 6:166936528-166936550 GGCAGAAGGCAAAGGGGAGCTGG + Intronic
1020437655 7:8183004-8183026 TCCACAACACAATGGTGATCAGG + Intronic
1020549859 7:9589824-9589846 AGCAGAAAACAATGGAAAGCAGG + Intergenic
1022232568 7:28428426-28428448 GGCAAGAGACAATGGTGGGCTGG + Intronic
1023180457 7:37477089-37477111 GGCACAACACAAGGGTCAGCTGG - Intergenic
1023433393 7:40117672-40117694 GGCAGGAGAGAGTGGTGAGCTGG - Intergenic
1024574997 7:50756028-50756050 CGCTGACCACAATGCTGAGCAGG - Intronic
1027706195 7:81536193-81536215 GGGAGAGCACACAGGTGAGCAGG - Intergenic
1028381581 7:90205952-90205974 GGCAGAAGACGAAGGGGAGCAGG - Intronic
1029446383 7:100615153-100615175 GGAGGAACACCATGGTGAGGAGG - Exonic
1030737356 7:113065364-113065386 GGCAGGACAGCATGGTGAGCAGG + Intergenic
1031526212 7:122823808-122823830 GGCAGAAGAGAAGGGTGAACAGG - Intronic
1034748615 7:153547065-153547087 GGAGGAAGACAATGGTGAGGAGG - Intergenic
1035404867 7:158590139-158590161 GGCAGAAGGCAAAGGGGAGCAGG - Intergenic
1036687830 8:10923658-10923680 GCCAGACCACATTGGTGAGGAGG + Intronic
1037254249 8:16934531-16934553 GGTAGAACAAAATGGCTAGCGGG - Intergenic
1037688840 8:21166078-21166100 GGCAGGATACAAAGGTGAACTGG - Intergenic
1038422106 8:27440078-27440100 GGCAGACCACCATGGTAGGCAGG + Intronic
1038489684 8:27961372-27961394 GGCAGAAGACAATGGGGAGTAGG - Intronic
1039830479 8:41209778-41209800 GGCAGAAGGCAAAGGGGAGCTGG - Intergenic
1041324581 8:56651315-56651337 GGCAGAAAACAAAGGGGAGCTGG + Intergenic
1044066336 8:87704181-87704203 GGCAAAATACAATGCTGTGCTGG + Intergenic
1044708375 8:95030888-95030910 GGCAGAAGACGAAGGGGAGCAGG + Intronic
1045211871 8:100107224-100107246 GGCAGAAGATAATGGAGAGGTGG + Intronic
1045546795 8:103136759-103136781 GACAGAACAGAAGGGTTAGCAGG - Intronic
1045590751 8:103593313-103593335 AGCAGCACACATTGGTCAGCTGG - Intronic
1045883881 8:107073149-107073171 GGCAAGACATAATGGTAAGCAGG + Intergenic
1046121579 8:109854288-109854310 GGCAGAAGGCAAAGGGGAGCAGG - Intergenic
1046954483 8:120048648-120048670 GGCAAAACAAAATGGAAAGCGGG - Intronic
1048753420 8:137705102-137705124 GGCAGAAGACAAAGGGGACCAGG + Intergenic
1049103175 8:140593993-140594015 GGCAGACCTCACTGGTGGGCAGG - Intronic
1052350323 9:27451942-27451964 GGCAAATCACAGAGGTGAGCAGG + Intronic
1055525636 9:77130399-77130421 GGCAGAAGGCAAAGGGGAGCAGG + Intergenic
1057495820 9:95560148-95560170 GGCAGGAGACAATGTTCAGCAGG + Intergenic
1059462495 9:114442723-114442745 GGCAGAAGGCAAAGGAGAGCAGG - Intronic
1061118387 9:128628610-128628632 GGCAGATTACAAAGGTGACCCGG - Intronic
1061502521 9:131012213-131012235 GGCAAAAGAGAATGCTGAGCTGG - Intronic
1185547513 X:957317-957339 GGCAGACCCAATTGGTGAGCGGG + Intergenic
1187169010 X:16832518-16832540 AGCAGAACAGCAGGGTGAGCAGG + Intronic
1188558802 X:31444111-31444133 GGCAGAAGGCAAAGGGGAGCTGG - Intronic
1189216824 X:39332404-39332426 GGCAGAAGGCAAAGGGGAGCTGG + Intergenic
1190148125 X:47917095-47917117 GGCAGAACACAGTGCAGAACAGG + Exonic
1193985013 X:88229437-88229459 GGCAAAACCCAGTGCTGAGCTGG + Intergenic
1196343525 X:114625156-114625178 GGCAGAATACTAAGGGGAGCTGG - Intronic
1197017040 X:121637246-121637268 GAATGAACACAATGGTGAGGTGG - Intergenic
1197602249 X:128543892-128543914 GGAAGAACAGTATGGTGAGGCGG - Intergenic
1197689792 X:129485842-129485864 GGCAGAAGGCAAAGGAGAGCTGG - Intronic
1198880852 X:141279535-141279557 GGAACAACACAATTGTAAGCAGG + Intergenic
1199260958 X:145774478-145774500 GGCAGAAGGTAAAGGTGAGCTGG + Intergenic
1201586402 Y:15565673-15565695 GGTAGAACACAAAGTTGAGTTGG + Intergenic