ID: 1125534658

View in Genome Browser
Species Human (GRCh38)
Location 15:40436302-40436324
Sequence CTCCAGAGGGAGAGCGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125534658_1125534667 8 Left 1125534658 15:40436302-40436324 CCCTCCACGCTCTCCCTCTGGAG No data
Right 1125534667 15:40436333-40436355 TGGAGCCTGACCTCAGCCGGAGG No data
1125534658_1125534673 26 Left 1125534658 15:40436302-40436324 CCCTCCACGCTCTCCCTCTGGAG No data
Right 1125534673 15:40436351-40436373 GGAGGCTGCCGCAGCTGCCGGGG No data
1125534658_1125534674 27 Left 1125534658 15:40436302-40436324 CCCTCCACGCTCTCCCTCTGGAG No data
Right 1125534674 15:40436352-40436374 GAGGCTGCCGCAGCTGCCGGGGG No data
1125534658_1125534672 25 Left 1125534658 15:40436302-40436324 CCCTCCACGCTCTCCCTCTGGAG No data
Right 1125534672 15:40436350-40436372 CGGAGGCTGCCGCAGCTGCCGGG No data
1125534658_1125534675 28 Left 1125534658 15:40436302-40436324 CCCTCCACGCTCTCCCTCTGGAG No data
Right 1125534675 15:40436353-40436375 AGGCTGCCGCAGCTGCCGGGGGG No data
1125534658_1125534666 5 Left 1125534658 15:40436302-40436324 CCCTCCACGCTCTCCCTCTGGAG No data
Right 1125534666 15:40436330-40436352 AGGTGGAGCCTGACCTCAGCCGG No data
1125534658_1125534671 24 Left 1125534658 15:40436302-40436324 CCCTCCACGCTCTCCCTCTGGAG No data
Right 1125534671 15:40436349-40436371 CCGGAGGCTGCCGCAGCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125534658 Original CRISPR CTCCAGAGGGAGAGCGTGGA GGG (reversed) Intergenic
No off target data available for this crispr