ID: 1125536174

View in Genome Browser
Species Human (GRCh38)
Location 15:40441936-40441958
Sequence CGCCGAAGACGGAAGGGGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 60}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125536166_1125536174 7 Left 1125536166 15:40441906-40441928 CCGACTCGATCGGGCTGAGAGGA 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1125536174 15:40441936-40441958 CGCCGAAGACGGAAGGGGACCGG 0: 1
1: 0
2: 0
3: 5
4: 60
1125536164_1125536174 8 Left 1125536164 15:40441905-40441927 CCCGACTCGATCGGGCTGAGAGG 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1125536174 15:40441936-40441958 CGCCGAAGACGGAAGGGGACCGG 0: 1
1: 0
2: 0
3: 5
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125536174 Original CRISPR CGCCGAAGACGGAAGGGGAC CGG Intronic
903886580 1:26544393-26544415 AGGCAAAGACAGAAGGGGACAGG - Intronic
906885393 1:49640007-49640029 GGCAGAAGAAGGAAGGAGACAGG + Intronic
919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG + Intronic
923163451 1:231337629-231337651 CGCAGCAGTCGGATGGGGACCGG - Exonic
923413978 1:233736746-233736768 GGAAGAAGACGGAAGAGGACTGG + Intergenic
1064316593 10:14263323-14263345 CGCAGGAGGGGGAAGGGGACGGG + Intronic
1067225818 10:44375075-44375097 CGCAGGAGGCGGGAGGGGACAGG + Intronic
1067248789 10:44570068-44570090 CGCAGAAGACTGAAGAAGACAGG + Intergenic
1070282260 10:75058431-75058453 CGCCGAAGATGGAGGAGGAAGGG - Exonic
1073099944 10:101001027-101001049 CGCCGAAGAGAGAAGGAAACAGG + Exonic
1078285619 11:9951733-9951755 CACCCAAGAAGGAAGAGGACAGG + Intronic
1081814887 11:45933426-45933448 CCCAGAAGAGGGAAGGGGAGTGG - Intronic
1089605648 11:119639864-119639886 CACCGGAGACGGATGGGGCCGGG - Intronic
1090392838 11:126400565-126400587 GGCCGCAGACTGAAGGGGCCTGG + Intronic
1090401572 11:126452731-126452753 AGCCAGAGACGGAAGAGGACCGG + Intronic
1101115384 12:101526420-101526442 AGCTGAAGACTGAAGAGGACAGG + Intergenic
1114195084 14:20469754-20469776 CACCGGAGCAGGAAGGGGACAGG + Intronic
1117135470 14:52730595-52730617 CGGCTAAGACGGTTGGGGACTGG - Intronic
1123460653 15:20467145-20467167 CTCCGAAGACGGGAAGGGACGGG + Intergenic
1123657408 15:22533271-22533293 CTCCGAAGACGGGAAGGGACGGG - Intergenic
1124271283 15:28282922-28282944 CTCCGAAGATGGGAAGGGACGGG + Intronic
1124311320 15:28628480-28628502 CTCCGAAGACGGGAAGGGACGGG - Intergenic
1125536174 15:40441936-40441958 CGCCGAAGACGGAAGGGGACCGG + Intronic
1128637700 15:69313795-69313817 CGCCTAAGAAGGAAAGGGACAGG + Intronic
1132282126 15:100628558-100628580 GGCAGAAGACGGACGAGGACTGG - Intronic
1141716320 16:85729128-85729150 CTCCACAGACGGAAGGGGAAAGG - Intronic
1144909964 17:18672710-18672732 CGACGAGGACGGCGGGGGACGGG - Intronic
1147612864 17:41811955-41811977 CCCCGCGGACGGAAGGGGACAGG + Exonic
1148097320 17:45061379-45061401 CGCAGATGATGGAAGGGAACGGG + Exonic
1150495347 17:65603772-65603794 GGTGGAAGACGGAAGGGGAAAGG + Intronic
1162384084 19:10350842-10350864 CGCTGAACACTGAAGGGGCCTGG + Exonic
1162823899 19:13239203-13239225 CGAAGAAGGCAGAAGGGGACAGG - Intronic
937907753 2:127060702-127060724 TGGCAAAGAGGGAAGGGGACAGG - Intronic
945251938 2:207771228-207771250 AGCCGGGGACGGAAGGGCACGGG - Intergenic
1169231210 20:3889784-3889806 CGGCGGGGCCGGAAGGGGACAGG - Intronic
1172122612 20:32607761-32607783 CACAGAAGAGAGAAGGGGACAGG - Intronic
1173543167 20:43869642-43869664 CACCCAAGATGGGAGGGGACCGG + Intergenic
1175302054 20:57949679-57949701 CTGAGAAGAGGGAAGGGGACAGG + Intergenic
1175944889 20:62554083-62554105 CGCCGAGGTCAGAAGGGGGCAGG + Intronic
1176234055 20:64046012-64046034 CGCTGAAGAGGGCAGGAGACAGG - Intronic
1178462801 21:32818339-32818361 TGCCAAAGAAGGAAGGGGAAGGG - Intergenic
1178566599 21:33692109-33692131 GGCTGAAGACAGGAGGGGACTGG + Intronic
1183406674 22:37633644-37633666 CTCCAAAGACGGAAGTGGAGAGG - Intergenic
954079711 3:48206525-48206547 GGCTCAAGACAGAAGGGGACAGG + Intergenic
956233913 3:67045108-67045130 GGCAGAAGACGGAAGGGAGCAGG + Intergenic
971667719 4:29512263-29512285 GGCAGCAGACGGAAGAGGACAGG + Intergenic
996540394 5:124625494-124625516 CGAAGAAGACGGAAGGTGCCTGG - Intergenic
1001849593 5:174951978-174952000 CCCCAAAGACGAAAGGGGCCTGG + Intergenic
1003233503 6:4275578-4275600 AGCCACAGACGGAAGGGGCCTGG + Intergenic
1005475599 6:26204656-26204678 CGGCAAAGGCGGAAAGGGACTGG + Exonic
1006510247 6:34517513-34517535 CGCAGATGAGGGAAGGGGAGGGG - Intronic
1013273348 6:108561403-108561425 CGACGAGGACGGCGGGGGACGGG + Exonic
1013803157 6:113970342-113970364 CGAGGAGGAGGGAAGGGGACGGG + Intronic
1019021906 6:168925913-168925935 AGCAGAAGATGGAAGGAGACCGG - Intergenic
1026013552 7:66654934-66654956 CGCCGAAGAGGGAGGCGGCCGGG - Intronic
1029545626 7:101208996-101209018 CGCAGAACGGGGAAGGGGACAGG + Intronic
1030021427 7:105278754-105278776 GGCAGAAGGCGGAAGGGGAAAGG + Intronic
1033587808 7:142787277-142787299 GGCAGAAGAGGGAAGGGGAGGGG + Intergenic
1036798016 8:11769833-11769855 CGGAGAAGTCGGGAGGGGACAGG + Exonic
1038720089 8:30027593-30027615 CGCCGAAGGCAGACGCGGACCGG + Intergenic
1049975874 9:861201-861223 TGCAGAAGACGGAAGGCGGCAGG - Intronic
1057192551 9:93095845-93095867 GGCCGACGACGGAGGGGGGCGGG + Intergenic
1057259655 9:93576640-93576662 CGCCGCGGCCGGGAGGGGACGGG - Exonic
1057618763 9:96617891-96617913 CGCCGAGGACGGATGGGGCTGGG - Intronic
1059411380 9:114134533-114134555 AGCAGGAGAGGGAAGGGGACAGG + Intergenic
1060536410 9:124392494-124392516 CGCACAAGAGGGCAGGGGACAGG + Intronic