ID: 1125537980

View in Genome Browser
Species Human (GRCh38)
Location 15:40453704-40453726
Sequence CTGTGGGAGGCCAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269561
Summary {0: 14, 1: 1357, 2: 26592, 3: 81400, 4: 160198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125537971_1125537980 16 Left 1125537971 15:40453665-40453687 CCGGGCTAGGTATGGTGGCTCAT 0: 3
1: 71
2: 1066
3: 4307
4: 8870
Right 1125537980 15:40453704-40453726 CTGTGGGAGGCCAAGGTGGAAGG 0: 14
1: 1357
2: 26592
3: 81400
4: 160198
1125537974_1125537980 -8 Left 1125537974 15:40453689-40453711 CCTGTAATCCCAGCACTGTGGGA 0: 2641
1: 295980
2: 261775
3: 149501
4: 132181
Right 1125537980 15:40453704-40453726 CTGTGGGAGGCCAAGGTGGAAGG 0: 14
1: 1357
2: 26592
3: 81400
4: 160198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125537980 Original CRISPR CTGTGGGAGGCCAAGGTGGA AGG Intronic
Too many off-targets to display for this crispr