ID: 1125553603

View in Genome Browser
Species Human (GRCh38)
Location 15:40566205-40566227
Sequence CCATCAGTAGCCAAGTAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 88}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125553598_1125553603 23 Left 1125553598 15:40566159-40566181 CCAGTTACTCTCTCCCAAGAAAC 0: 1
1: 0
2: 1
3: 18
4: 153
Right 1125553603 15:40566205-40566227 CCATCAGTAGCCAAGTAACTTGG 0: 1
1: 0
2: 1
3: 11
4: 88
1125553599_1125553603 10 Left 1125553599 15:40566172-40566194 CCCAAGAAACACGTGATGAAAGA 0: 1
1: 0
2: 0
3: 16
4: 213
Right 1125553603 15:40566205-40566227 CCATCAGTAGCCAAGTAACTTGG 0: 1
1: 0
2: 1
3: 11
4: 88
1125553600_1125553603 9 Left 1125553600 15:40566173-40566195 CCAAGAAACACGTGATGAAAGAC 0: 1
1: 0
2: 0
3: 1
4: 144
Right 1125553603 15:40566205-40566227 CCATCAGTAGCCAAGTAACTTGG 0: 1
1: 0
2: 1
3: 11
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125553603 Original CRISPR CCATCAGTAGCCAAGTAACT TGG Intergenic
905319284 1:37104580-37104602 AAAAGAGTAGCCAAGTAACTAGG + Intergenic
907146877 1:52242691-52242713 CCATCAGTACATAAGAAACTAGG - Intronic
916359299 1:163950277-163950299 CCATCAGAAGTAAAGTAACGAGG - Intergenic
921357983 1:214304442-214304464 ACATCAGCTCCCAAGTAACTGGG - Intronic
923668348 1:236018564-236018586 CCATCAGTGGCCACATAACCAGG - Intronic
924444038 1:244111909-244111931 CCAACAGAAGCCTAGTACCTTGG - Intergenic
1064148003 10:12840655-12840677 CCATCAGTAGCCAGGTCTGTGGG - Intergenic
1065134971 10:22659007-22659029 CCACCAGAATCCAAGAAACTTGG + Intronic
1065200191 10:23304962-23304984 CCAGCAGCAGCCACGTAACTCGG + Intronic
1065611058 10:27471002-27471024 CCTTCAGTAGCCAAATCCCTGGG - Intergenic
1067227059 10:44383296-44383318 CCATTGGCAGCCAAGTAACCAGG - Intronic
1067973684 10:50999787-50999809 GCATATGTAGCCAAGTACCTTGG - Intronic
1074988343 10:118678296-118678318 CTATCAGTAGATAAGTAATTTGG - Exonic
1079779302 11:24579573-24579595 ACATCAGTAGTCAAGTAAATTGG - Intronic
1090170884 11:124603100-124603122 CCATCAATAGGCAAGTGAGTAGG + Intergenic
1091251499 11:134147861-134147883 TCAACAAGAGCCAAGTAACTTGG - Intronic
1094241472 12:28230737-28230759 GCAACAGCATCCAAGTAACTGGG + Intronic
1094384054 12:29874239-29874261 ACAGCAGAAGCTAAGTAACTTGG - Intergenic
1097881628 12:64691644-64691666 CCATCAATAGCCAAGTCACTAGG - Intronic
1098175315 12:67784196-67784218 ACAGCAGTAGGCAAGAAACTGGG + Intergenic
1099074182 12:78084275-78084297 CCATCAGTAGGGAGGTAGCTGGG - Intronic
1099846190 12:88031318-88031340 CCATCTGTAGCCTAGGGACTTGG - Intronic
1103635620 12:122302710-122302732 ATGTCAGTATCCAAGTAACTGGG + Intronic
1104535100 12:129611472-129611494 CCATGAGTAAGGAAGTAACTGGG - Intronic
1112116494 13:96360829-96360851 GCCTCAGTTTCCAAGTAACTGGG - Intronic
1116024062 14:39495197-39495219 GCCTCAGTCCCCAAGTAACTGGG + Intergenic
1118924466 14:70179395-70179417 CCAGCACTAGCCAAGGCACTGGG - Intronic
1121457033 14:94044851-94044873 CCATCCGTAGCCAAGGGACTCGG + Intronic
1122303703 14:100747918-100747940 CCATGGGCAGCCAAGTTACTAGG + Intergenic
1125553603 15:40566205-40566227 CCATCAGTAGCCAAGTAACTTGG + Intergenic
1128404242 15:67318814-67318836 AAATCATTAGCCAAGTGACTTGG - Intronic
1130612613 15:85375164-85375186 CAATCAGTAGCTATGTGACTTGG + Intergenic
1133150023 16:3821080-3821102 CCCTCATCAGCCATGTAACTGGG + Intronic
1146145592 17:30413425-30413447 CCACCATAAGCCTAGTAACTCGG - Intronic
1146828804 17:36048186-36048208 CCCTCAGTAGCCAAGTGATAAGG - Intergenic
1150157042 17:62862420-62862442 CCTTCAGTTCCCAAGTAGCTGGG - Intergenic
1159563508 18:70021939-70021961 CACTCAGTAGCCCAGCAACTGGG - Intronic
1161045619 19:2132880-2132902 CCAGGAGGAGCCAAGAAACTTGG - Intronic
1164150918 19:22550319-22550341 CCATCAGTGGCAATGTAAATTGG + Intergenic
1164523270 19:28995062-28995084 CCAGCAGTAGCCATGTCACCTGG - Intergenic
930285589 2:49423751-49423773 CCAGCAGTAGCCTAATAAGTAGG - Intergenic
930650574 2:53960566-53960588 CAACCAGTAGCCAAGTAAGCAGG + Intronic
933248284 2:80000083-80000105 CCATCAGTGGCCAAAAAACAAGG - Intronic
933484429 2:82899999-82900021 AGTTCAGTACCCAAGTAACTGGG + Intergenic
934609725 2:95726014-95726036 CAAACAGAAGCCAAGCAACTTGG - Intergenic
936543044 2:113367584-113367606 CAAACAGAAGCCAAGCAACTTGG - Intergenic
941039672 2:160606970-160606992 ACATCACTAGCCAAGTGACAAGG - Intergenic
943920117 2:193696258-193696280 GTATCAGTAGCCAAGTAGCCAGG + Intergenic
1170440745 20:16376640-16376662 CCTTCAGAAGCCAAGTAAAGGGG - Intronic
1171070895 20:22067569-22067591 CTATCTGTAGCTAAGTAACTGGG + Intergenic
1172748430 20:37231852-37231874 CCACCATTAGCCAATTAAGTGGG + Intronic
1176076245 20:63249650-63249672 CCCTCAGTAGCCAGGGATCTGGG - Intronic
1176223929 20:63983767-63983789 GCCTCAGTCTCCAAGTAACTGGG + Intronic
1177777270 21:25581852-25581874 TCCTGAGTAGCCAAGTAGCTGGG - Intergenic
1178026395 21:28473130-28473152 CCATCATTACCCAGGTAACGAGG - Intergenic
953754043 3:45631452-45631474 CCATAAGAAGCCAAGTAGGTAGG - Intronic
961489512 3:127244613-127244635 CCATCAGAAGCCATGCAACATGG + Intergenic
962882253 3:139589091-139589113 CCACCAGGAGCAAAGGAACTTGG + Intronic
963077603 3:141361764-141361786 CCATCAGTAGTGAAGTATTTGGG - Intronic
966742530 3:183247536-183247558 ACAGGAGTATCCAAGTAACTCGG + Intronic
969138466 4:5050000-5050022 CCCTCATTAGCCAGTTAACTTGG - Intergenic
970236473 4:13963770-13963792 CCAACACTAGCCAAGGAAGTAGG + Intergenic
973227336 4:47801582-47801604 CCAGCAGTAGCCATGCAGCTTGG + Intronic
974181324 4:58387266-58387288 GCACCAGCAACCAAGTAACTGGG - Intergenic
977601485 4:98938223-98938245 TCTTCAGCAGCCAAGTAGCTTGG + Intergenic
980024486 4:127748687-127748709 CCAGCAGCAGCCATGTGACTTGG + Intronic
980395796 4:132213559-132213581 ACATTAATAGCCATGTAACTGGG + Intergenic
981007370 4:139889680-139889702 CAATCAGCAGCCAAATAACTTGG - Exonic
981023015 4:140048567-140048589 CCATAATTACCCAGGTAACTTGG + Intronic
984230546 4:177093019-177093041 CCATCATTTCCCAAGTAACAAGG + Intergenic
986468813 5:8053256-8053278 GCATCAGTAGAGAAGTAAATGGG - Intergenic
997076718 5:130687363-130687385 CGATCTGTGGCCAAGTAACCAGG + Intergenic
999544274 5:152609652-152609674 CAATCAGTAGCCAAGGAGATGGG + Intergenic
1004990388 6:21130713-21130735 CCACCAGTAGACAAGTAAAAAGG - Intronic
1008790851 6:55230969-55230991 CCATAATTAGCCAAGTTAGTTGG + Intronic
1016966275 6:149721208-149721230 GCCTCAGCATCCAAGTAACTTGG + Intergenic
1021890748 7:25184097-25184119 CCTTGAGTAGCTAAGGAACTAGG + Intergenic
1025189538 7:56886178-56886200 CAATCAGTAGCCAAGCACCATGG + Intergenic
1025682402 7:63690739-63690761 CAATCAGTAGCCAAGCACCATGG - Intergenic
1027641032 7:80734155-80734177 CCATCAGGGGCCAAGGGACTTGG + Intergenic
1028016771 7:85725010-85725032 GCATCAGTAGCCATATCACTGGG - Intergenic
1028099596 7:86803659-86803681 CAATCCTTAGCCAAGTAACTTGG - Intronic
1039020879 8:33204806-33204828 CCATCAGAATCCAACTATCTTGG - Intergenic
1039543190 8:38388193-38388215 CCCTCAGCCTCCAAGTAACTGGG + Intronic
1040585003 8:48731737-48731759 CCATCATTATTCTAGTAACTTGG - Intronic
1041797687 8:61762688-61762710 CCATCAGGAGACAAGTAAGTGGG - Intergenic
1046251651 8:111640227-111640249 CATTTTGTAGCCAAGTAACTCGG - Intergenic
1047244793 8:123132056-123132078 CCATCAGTTGGCAAATGACTTGG - Intronic
1048050575 8:130812189-130812211 CTATCAGTAGCCAATTGACTAGG + Intronic
1050301917 9:4267553-4267575 CTATCGGTAGCTAAGTAGCTAGG - Intronic
1059277539 9:113108867-113108889 CCATCAGGACCCATGGAACTGGG + Intergenic
1059278712 9:113115684-113115706 CCATCAGGACCCATGGAACTGGG - Intergenic
1060672200 9:125479700-125479722 CCATCAGAAGACAAGCAACTGGG + Intronic
1189551301 X:42096354-42096376 TCATCCTTAGCCAAGTATCTGGG + Intergenic
1189751327 X:44225779-44225801 TCCTCACTAGCCAAGTAACTTGG - Intronic
1190372068 X:49752440-49752462 TCACCAGTAACCAAGTAAGTTGG + Intergenic
1190394872 X:49971677-49971699 CCATGGGTAGCCAAGAAAATGGG - Intronic
1191893071 X:65964400-65964422 CCAGCAGCAGCCCAGTTACTGGG + Intergenic
1192593966 X:72387188-72387210 CCATTTGTAGCCAAGGAACTAGG - Intronic
1192886377 X:75338854-75338876 CCATCAGTTGCCATCTTACTTGG - Intergenic
1201958502 Y:19651598-19651620 CCATCAGTAGCCACATAAGATGG - Intergenic