ID: 1125556572

View in Genome Browser
Species Human (GRCh38)
Location 15:40590732-40590754
Sequence CGTTTTACGCAGTCAGTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 4, 3: 5, 4: 32}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125556568_1125556572 -2 Left 1125556568 15:40590711-40590733 CCCAGACAAAGAAAGTAGCCACG 0: 1
1: 0
2: 1
3: 15
4: 149
Right 1125556572 15:40590732-40590754 CGTTTTACGCAGTCAGTGGCCGG 0: 1
1: 0
2: 4
3: 5
4: 32
1125556565_1125556572 17 Left 1125556565 15:40590692-40590714 CCTCCAGGAAAGTCTGAGCCCCA 0: 1
1: 0
2: 1
3: 24
4: 240
Right 1125556572 15:40590732-40590754 CGTTTTACGCAGTCAGTGGCCGG 0: 1
1: 0
2: 4
3: 5
4: 32
1125556567_1125556572 -1 Left 1125556567 15:40590710-40590732 CCCCAGACAAAGAAAGTAGCCAC 0: 1
1: 2
2: 7
3: 22
4: 185
Right 1125556572 15:40590732-40590754 CGTTTTACGCAGTCAGTGGCCGG 0: 1
1: 0
2: 4
3: 5
4: 32
1125556569_1125556572 -3 Left 1125556569 15:40590712-40590734 CCAGACAAAGAAAGTAGCCACGT 0: 1
1: 0
2: 8
3: 6
4: 112
Right 1125556572 15:40590732-40590754 CGTTTTACGCAGTCAGTGGCCGG 0: 1
1: 0
2: 4
3: 5
4: 32
1125556566_1125556572 14 Left 1125556566 15:40590695-40590717 CCAGGAAAGTCTGAGCCCCAGAC 0: 1
1: 4
2: 11
3: 25
4: 205
Right 1125556572 15:40590732-40590754 CGTTTTACGCAGTCAGTGGCCGG 0: 1
1: 0
2: 4
3: 5
4: 32
1125556564_1125556572 30 Left 1125556564 15:40590679-40590701 CCAGTAGGACTAGCCTCCAGGAA 0: 1
1: 0
2: 1
3: 3
4: 132
Right 1125556572 15:40590732-40590754 CGTTTTACGCAGTCAGTGGCCGG 0: 1
1: 0
2: 4
3: 5
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125556572 Original CRISPR CGTTTTACGCAGTCAGTGGC CGG Intergenic
904237904 1:29125720-29125742 GGTTTTAAGCAGGTAGTGGCAGG - Intergenic
1064401853 10:15028110-15028132 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1067004122 10:42645428-42645450 CCTTTTAAGCAGTCAGTGGCCGG - Intergenic
1067005248 10:42654821-42654843 CATTTTAAGCAATCAGTGGCCGG - Intergenic
1078071281 11:8113199-8113221 TCTTTTAAGCATTCAGTGGCTGG - Intronic
1078513677 11:12006111-12006133 CATTTTAGGCAGTCAGCGGATGG + Intronic
1107490278 13:40874888-40874910 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1107748260 13:43536039-43536061 CGTTCTACACATTCAGCGGCAGG + Intronic
1116988325 14:51245254-51245276 CGTTTTAAGTAGTCAGTGATTGG + Intronic
1117316561 14:54576833-54576855 CCCTTTAGGCAGACAGTGGCTGG - Intronic
1123223424 14:106877858-106877880 CCTTTTACACAGTCAGTGGCTGG - Intergenic
1125556572 15:40590732-40590754 CGTTTTACGCAGTCAGTGGCCGG + Intergenic
1127570344 15:60235427-60235449 CATTTCACAGAGTCAGTGGCTGG - Intergenic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1131527273 15:93162466-93162488 CCTTTTAAGTAGTCGGTGGCCGG + Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1133506575 16:6418234-6418256 CATTTTAGCCAGTGAGTGGCCGG + Intronic
1149744531 17:59082961-59082983 TGTTTTACGGAGAGAGTGGCAGG - Intronic
1155742918 18:29312697-29312719 TGCTTGAAGCAGTCAGTGGCAGG + Intergenic
1164203270 19:23036128-23036150 CCTTTTAAGCAGTCAGCAGCCGG + Intergenic
930190284 2:48451904-48451926 CCTTTTACGTAGTCAGTTGTTGG + Intronic
944678713 2:202056211-202056233 TGTCATACGCAGTCATTGGCTGG + Intergenic
945972407 2:216243560-216243582 TGTTGTACTCAGTCATTGGCTGG - Intergenic
1176874548 21:14115381-14115403 CCTTTTAAGCTGTCAGTGGCCGG - Intronic
1176875681 21:14124658-14124680 CCTTTTAAGCTGTCAGTGTCCGG - Intronic
949993577 3:9599525-9599547 CTTCTTACGCAGTCAGTTACTGG + Intergenic
967051790 3:185791743-185791765 TGCTATAAGCAGTCAGTGGCTGG - Intronic
979671074 4:123360751-123360773 TGTTTTCCCTAGTCAGTGGCAGG + Intergenic
1008237761 6:49070658-49070680 TGTTGTACTCAGTCATTGGCTGG - Intergenic
1016972705 6:149779339-149779361 CCTTTTAAGCAGTTTGTGGCAGG - Intronic
1019630843 7:2048898-2048920 TGGTTGACGCGGTCAGTGGCTGG - Intronic
1023718874 7:43072595-43072617 CTTTTTAAGCAGCCAGTGGCCGG + Intergenic
1031340684 7:120596291-120596313 CTTTTTAAGCAGACATTGGCTGG - Intronic
1034956469 7:155338425-155338447 CGTATACCGCGGTCAGTGGCCGG + Intergenic
1037960823 8:23096758-23096780 CCTTTTAAGCAGTTTGTGGCAGG + Intronic
1040483988 8:47853265-47853287 CCTTTTAGACAGTCACTGGCTGG - Intronic
1058441698 9:105014400-105014422 TGTTTAATGCTGTCAGTGGCAGG + Intergenic
1061628397 9:131856035-131856057 CCTTTCATGCAGTCAGTGGTGGG + Intergenic
1185874459 X:3691135-3691157 CCTTTTAAGCAGTTTGTGGCGGG + Intronic
1197149563 X:123205175-123205197 TGTTTTTCCCAGTAAGTGGCTGG + Intronic
1202358542 Y:24077938-24077960 TTTTTTACGCAGTCAATAGCTGG - Intergenic
1202512236 Y:25592175-25592197 TTTTTTACGCAGTCAATAGCTGG + Intergenic