ID: 1125564672

View in Genome Browser
Species Human (GRCh38)
Location 15:40667588-40667610
Sequence CTGTTTCAGAAGAGGAAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125564664_1125564672 23 Left 1125564664 15:40667542-40667564 CCTCATGAAATGGATTAATGTGT No data
Right 1125564672 15:40667588-40667610 CTGTTTCAGAAGAGGAAGAGAGG No data
1125564663_1125564672 24 Left 1125564663 15:40667541-40667563 CCCTCATGAAATGGATTAATGTG No data
Right 1125564672 15:40667588-40667610 CTGTTTCAGAAGAGGAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125564672 Original CRISPR CTGTTTCAGAAGAGGAAGAG AGG Intergenic
No off target data available for this crispr