ID: 1125574176

View in Genome Browser
Species Human (GRCh38)
Location 15:40744149-40744171
Sequence ACTGCAGACCAGACAGAAAC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125574172_1125574176 -8 Left 1125574172 15:40744134-40744156 CCTGCCGGCTTCCATACTGCAGA 0: 1
1: 0
2: 1
3: 8
4: 85
Right 1125574176 15:40744149-40744171 ACTGCAGACCAGACAGAAACGGG 0: 1
1: 0
2: 3
3: 22
4: 211
1125574169_1125574176 10 Left 1125574169 15:40744116-40744138 CCAGGCGCCAGAGAAAGTCCTGC 0: 1
1: 0
2: 0
3: 15
4: 171
Right 1125574176 15:40744149-40744171 ACTGCAGACCAGACAGAAACGGG 0: 1
1: 0
2: 3
3: 22
4: 211
1125574171_1125574176 3 Left 1125574171 15:40744123-40744145 CCAGAGAAAGTCCTGCCGGCTTC 0: 1
1: 0
2: 1
3: 9
4: 123
Right 1125574176 15:40744149-40744171 ACTGCAGACCAGACAGAAACGGG 0: 1
1: 0
2: 3
3: 22
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125574176 Original CRISPR ACTGCAGACCAGACAGAAAC GGG Exonic
901742927 1:11354078-11354100 ACAGCAGACCAGACTCAAAATGG - Intergenic
901750849 1:11407302-11407324 ACTGCAAACCAGACATGCACAGG - Intergenic
902138506 1:14332123-14332145 CCTGCAGACCCCACAGAAATAGG + Intergenic
904452064 1:30619788-30619810 ACTTCAGACCAGACACAAAACGG + Intergenic
908272291 1:62433714-62433736 ACTGGGGAGCACACAGAAACTGG + Intergenic
908647611 1:66295814-66295836 GCTGCAGAGAGGACAGAAACTGG - Intronic
909445882 1:75747741-75747763 GCTGCAGTACAGACAGCAACAGG - Intronic
910144666 1:84065568-84065590 AATGAAGATCAGACAGATACAGG - Intergenic
910476046 1:87608639-87608661 ACGGCTGCCCAGACAAAAACTGG + Intergenic
913996406 1:143654515-143654537 TCTGCAGACCCAACGGAAACAGG - Intergenic
916293942 1:163196309-163196331 ACTGCTGGCCAGAGAGAAAAGGG - Intronic
917371772 1:174301046-174301068 ACTGCAGACCGGGCATGAACTGG - Intronic
917680957 1:177366815-177366837 ACAGCAGAACAGCCAGAAACAGG + Intergenic
918894866 1:190329065-190329087 AATGCTGACCAGGCAAAAACTGG + Intronic
920353506 1:205353184-205353206 ATTTCAGGCCATACAGAAACAGG - Intronic
920856221 1:209664419-209664441 AGTGAATACCAGACAGAAGCTGG - Intergenic
922504042 1:226116161-226116183 ACTGCAGAGGAGACAGGAAAGGG - Intergenic
924637028 1:245798235-245798257 ACTGCAGACCAGCTCGACACAGG - Intronic
1062835496 10:632960-632982 ACTGGAGACCACACAGGCACCGG + Intronic
1063879746 10:10518940-10518962 ACTTCAGACCAAAAAGAATCAGG + Intergenic
1068554419 10:58442699-58442721 ACTGCAGAGAAGTCAGAAATAGG - Intergenic
1070193812 10:74137951-74137973 ACTGTATACCACACAGAAAAGGG + Intronic
1070549497 10:77480060-77480082 CCTGCAGCCAAGACAGAAGCTGG + Intronic
1072923449 10:99595992-99596014 ACTGGACACCAGGCAGCAACTGG + Intergenic
1074345500 10:112681447-112681469 CCTGCAGGCCATACAAAAACAGG - Intronic
1075180642 10:120207676-120207698 ACTTCAGCCCAGACAGGAAGGGG - Intergenic
1076698009 10:132256397-132256419 ATTTCAGACCAGACAGGACCAGG - Intronic
1076787921 10:132760245-132760267 GCTGCAGCCCAGACAGGCACAGG + Intronic
1077457567 11:2690058-2690080 CCTTCAGCCCAGACAGAAGCAGG - Intronic
1078365533 11:10703389-10703411 AAAGCAGAACAGACAGAAAAAGG + Intergenic
1079358323 11:19748780-19748802 GGTGCAGACCAAAGAGAAACAGG + Intronic
1080757946 11:35220183-35220205 AAGACAGACCAGACAGAGACAGG + Intronic
1081304836 11:41499613-41499635 ACTGCAGACGAGATAGAAAAAGG - Intergenic
1081643830 11:44776577-44776599 ACGGCAGAGCAGAAAGAAGCTGG - Intronic
1081809353 11:45906450-45906472 ACTGCAGTCCAGACAGGAAATGG - Exonic
1083848577 11:65351993-65352015 AATGGAGAGCAGAGAGAAACTGG - Exonic
1084029304 11:66471809-66471831 ACTGCAGGTCAGAGAGAAACTGG - Intronic
1084982964 11:72842046-72842068 ACTGCAGGCCAGACAGGTAGAGG - Intronic
1085190751 11:74619829-74619851 AATCCACACCAGACAGTAACTGG - Intronic
1085385200 11:76153601-76153623 ACTTCTGACCAGACAGAGCCTGG - Intergenic
1085736726 11:79045541-79045563 ACTGCAGACCTGTCAGTAAGGGG - Intronic
1086729572 11:90231115-90231137 ACTGTAGTCCAAACAGAAATAGG + Intergenic
1086769727 11:90746825-90746847 TCTAAAGAACAGACAGAAACAGG - Intergenic
1088306966 11:108421204-108421226 ACAGCAGACAAGGCAGGAACAGG - Intronic
1089021855 11:115223996-115224018 ACTGGAGATCAGAGAGAAACAGG + Intronic
1090001087 11:122959379-122959401 ACTGCAGAACAGACACGAAAGGG + Exonic
1091885836 12:4016398-4016420 GCAGCAGCCCAGATAGAAACAGG + Intergenic
1092501899 12:9056226-9056248 ACTGCAAACCATACTGAATCAGG + Intergenic
1096738655 12:53676061-53676083 ACTGCAGAGAAGACAGAGAGGGG + Exonic
1101092929 12:101306107-101306129 ACTGCAGTCCATATAGAAACAGG - Intronic
1102898969 12:116621319-116621341 ACTTTAGACCAGAGAGAAAGTGG + Intergenic
1102917711 12:116767128-116767150 ACTGAAAACTAAACAGAAACAGG + Intronic
1106421916 13:29592324-29592346 ACCACAGACCAGCCAGAATCTGG + Intronic
1107342251 13:39420442-39420464 AGTGCTTACCAGCCAGAAACTGG + Intronic
1109524794 13:63561737-63561759 ACAGCAGCCCAGACAGACAAAGG - Intergenic
1112210118 13:97368027-97368049 ACTTCAGACTTGAAAGAAACAGG - Intronic
1115273302 14:31578421-31578443 ATTCCTGACCAGAAAGAAACAGG - Intronic
1115452735 14:33566696-33566718 ACTACAGAGAAGAAAGAAACTGG - Intronic
1116157462 14:41225059-41225081 ACTGAAGACTAGAAGGAAACAGG - Intergenic
1119659793 14:76442146-76442168 ACTGAAGCACAGAGAGAAACAGG - Intronic
1122774971 14:104113088-104113110 ACAGAAAACCAGACAGCAACTGG - Exonic
1123353980 15:19220890-19220912 ATTGCAGACTCCACAGAAACAGG - Intergenic
1123383758 15:19715793-19715815 ACTGCAGATTCCACAGAAACAGG - Intergenic
1123696160 15:22880618-22880640 ACTCCAGCCCAGACAGAAACCGG + Intronic
1125574176 15:40744149-40744171 ACTGCAGACCAGACAGAAACGGG + Exonic
1125804394 15:42480542-42480564 AATCCAAACAAGACAGAAACAGG - Intronic
1126352954 15:47764256-47764278 ACTGCTGTCCAAACAGAATCTGG - Exonic
1126706591 15:51411792-51411814 TTTGCAGACCATACAAAAACAGG + Intergenic
1128681321 15:69654067-69654089 ACTGCAGAGCAGGCAGTAGCTGG - Intergenic
1129657969 15:77537234-77537256 ACTGCAGCAGAGGCAGAAACTGG - Intergenic
1129855447 15:78821434-78821456 ACACCAGTCCAGACAGAAACAGG + Intronic
1130616441 15:85413277-85413299 ACTTCAGAACAGACCGTAACTGG + Intronic
1130950770 15:88585539-88585561 ACTGATGAACAGACAAAAACCGG + Intergenic
1131731518 15:95287033-95287055 CCTGCCTACCAGACAGAAAGAGG + Intergenic
1132283918 15:100645485-100645507 AGAGCAGACTAGACAGACACAGG - Intronic
1132332809 15:101024518-101024540 TCTGCAGCCCAGACAGAGCCAGG + Intronic
1132468997 16:91415-91437 ACTGGAGCCCAGGCAGAACCTGG + Intronic
1133499025 16:6347901-6347923 CATGCAGATCATACAGAAACTGG + Intronic
1134772876 16:16825528-16825550 ACTGCAGACCCCACTGAAAGTGG - Intergenic
1134847139 16:17449455-17449477 ACTGAAGACCAGCCAGACAGGGG - Intronic
1136408472 16:30063450-30063472 ACTGAGGACCAGAGAGCAACTGG - Intronic
1137931103 16:52588459-52588481 ACAGTAGACCAGACAGTGACAGG - Intergenic
1140479831 16:75256585-75256607 ACTTCAGGCCTGTCAGAAACAGG + Intronic
1143307342 17:5958007-5958029 CCTGCAAACCAGACAGATCCGGG - Intronic
1144395489 17:14838879-14838901 ACTGCAGACCAGACAGGTTGGGG + Intergenic
1146129530 17:30259366-30259388 ACAGCAGAGCAGACAGAAAATGG - Intronic
1147367109 17:39966253-39966275 CCTGCAGACCCAACAGACACTGG + Exonic
1147626958 17:41906646-41906668 CCTGGGGACCAGACAGCAACAGG + Exonic
1149996456 17:61408428-61408450 ACTGCAGAGCATCCAGAGACTGG + Exonic
1150410584 17:64937804-64937826 GATGCAGTCCAGACAGAAATGGG - Intergenic
1150874546 17:68954435-68954457 ACTGCAGAACATACAAAAATTGG - Intronic
1152343147 17:79736366-79736388 ACTGGGGACCAGCTAGAAACAGG - Intronic
1152438081 17:80288321-80288343 ACTGCAGACCACCGAGCAACAGG + Exonic
1152735674 17:81995801-81995823 GCTGCAGACCAGACTCAAGCTGG + Intronic
1155797497 18:30058858-30058880 ACTGCCACCCAAACAGAAACAGG + Intergenic
1156110468 18:33719915-33719937 ATTGCAGACCAGACAGACTAAGG + Intronic
1156637288 18:39047072-39047094 ACCACTGACCAGAAAGAAACTGG + Intergenic
1157599622 18:48885975-48885997 AGGGCAGACCAGACAAAAGCAGG + Intergenic
1157704230 18:49789182-49789204 GCTGCAGACCAAAAAAAAACGGG - Intronic
1160218985 18:76958731-76958753 ACTGCAGACCAGGCAGAGCCAGG - Intronic
1162156090 19:8678937-8678959 ACTGAAGACCAGACTGAAGGAGG + Intergenic
1163386712 19:17004501-17004523 ACTGGAGACCACAGAGAAGCTGG + Intronic
1164295935 19:23910040-23910062 CCTTCAGACCTGACAGAAAGAGG - Intergenic
1164452573 19:28379554-28379576 ACTGTAGACCAGACAGACCAAGG + Intergenic
1166849187 19:45750188-45750210 ACTGCAGACCAGTGAGACAGGGG + Intronic
1168718870 19:58544157-58544179 CCTCCAGACCACACAGAAGCGGG - Intronic
925422933 2:3726425-3726447 ACTGCAGATAAGACACAAAGGGG - Intronic
927316502 2:21689270-21689292 ACAGCTGACCAGAAAGAGACTGG - Intergenic
927476038 2:23414748-23414770 GCTGCAGACCAGTCTGAGACCGG - Intronic
928213610 2:29342752-29342774 ACTGGAAACCAAACAGAAAGGGG - Intronic
929856636 2:45643420-45643442 ACAGCAGAACAGAAAGCAACTGG - Intergenic
930179518 2:48338830-48338852 ACTGTAGACCATAAAGAAAAGGG + Intronic
930855322 2:56009958-56009980 TCTGCAAACCAGACAGAAGAGGG - Intergenic
936169558 2:110156592-110156614 ACTGCAGAGCATTCAGAAGCAGG - Intronic
937758568 2:125571512-125571534 GCTGCAGACCAGAAAGAAATGGG - Intergenic
941270430 2:163420097-163420119 ACTGAAAACCAAACTGAAACAGG + Intergenic
943982203 2:194568536-194568558 ATTTCAGATGAGACAGAAACAGG - Intergenic
944852267 2:203732136-203732158 GCTGCAGACCAGCCAAAAATAGG - Intronic
947235024 2:227932185-227932207 ATTTCGGACCAGAGAGAAACTGG - Intergenic
947620813 2:231589837-231589859 AGTGCTGACATGACAGAAACAGG - Intergenic
948186199 2:236023419-236023441 GCTCCAGTTCAGACAGAAACTGG + Intronic
1171414238 20:24966791-24966813 CCTGCAGACCGGACAGTCACAGG + Intronic
1174957387 20:55114431-55114453 ACTGCAGGCCAGTCAGAAACTGG + Intergenic
1175613445 20:60371766-60371788 AGGGCAGACCAGAAAGAACCAGG - Intergenic
1175740648 20:61417575-61417597 AATGCATTCCAGCCAGAAACAGG - Intronic
1178758763 21:35379865-35379887 ACTAAAAAGCAGACAGAAACGGG + Intronic
1178940326 21:36900231-36900253 ACTTCAGACCAGACAGATGGAGG + Intronic
1180048070 21:45318774-45318796 CCTGCAGAGCAGATAGACACAGG - Intergenic
1180881789 22:19209484-19209506 ATTGCTCACCAGGCAGAAACAGG + Intronic
1181261265 22:21599541-21599563 ACTTAAGACCAAACAGAAGCAGG + Intronic
1182861657 22:33565012-33565034 ACTTCAGACTAGACAGAACAAGG + Exonic
1185039168 22:48495650-48495672 ACGGCAGCCCAGACAGAGAGAGG - Intronic
949414477 3:3800180-3800202 AAGGCAGGCCAGATAGAAACAGG + Intronic
949825366 3:8159324-8159346 ACTGAAGACCAGACACCAGCTGG + Intergenic
950361498 3:12452599-12452621 ACTGAAGCCCAGAGAGAAAAGGG + Intergenic
950629769 3:14274752-14274774 ACTCCAGACCAGACTGAAGCAGG - Intergenic
951757030 3:26102141-26102163 ACTGGAGACCTGACAGCAACTGG - Intergenic
953256257 3:41293082-41293104 ACTGCACTCCAGACAGAGAGAGG + Intronic
953677123 3:45011604-45011626 AGTAAAGACCTGACAGAAACTGG + Intronic
954594907 3:51815926-51815948 CCTGCAGACAGGACAGACACAGG + Intergenic
955946908 3:64204210-64204232 ACTGAAAACCAGAAAGAAGCAGG + Intronic
958187580 3:90142823-90142845 ACTGTAGACCACTTAGAAACAGG - Intergenic
959700449 3:109293680-109293702 ACTGCAGACAGGACAGATAAGGG - Intergenic
959976913 3:112471228-112471250 GCAGCAGAACAGGCAGAAACAGG + Exonic
960365210 3:116762700-116762722 ACTGAGGAGCAGACAGAAAGAGG + Intronic
961608257 3:128114558-128114580 ACTGCAGGCCAAACAGAACCAGG - Intronic
962778171 3:138683882-138683904 TCTGCAGACCTGACAGGAATAGG - Intronic
963993245 3:151677934-151677956 ACTCCACACCAGGCAGCAACTGG - Intergenic
964012004 3:151902895-151902917 ACTACAGTCCAGCAAGAAACAGG + Intergenic
964587454 3:158322426-158322448 AATGCAGACCAGATGGCAACTGG - Intronic
965647887 3:170902996-170903018 ACTGAAAACCTCACAGAAACAGG + Intronic
966757457 3:183384762-183384784 CCTGCTGCCCAGACAGAACCAGG - Intronic
968089753 3:195892717-195892739 CCTGGAGAGAAGACAGAAACAGG - Intronic
970120398 4:12746837-12746859 ATTAAAGACAAGACAGAAACTGG - Intergenic
970381614 4:15513669-15513691 ACTGCAGAGAAGACAGAAAAGGG - Intronic
972733461 4:41817482-41817504 ACTGAAGACCAGGCAGAGGCAGG - Intergenic
973270977 4:48263136-48263158 ACATCAGCCCAGCCAGAAACAGG + Intronic
973748412 4:53987174-53987196 AATGCAGACCATACAGAACAAGG - Intronic
974655621 4:64816506-64816528 ACTGCAGTCAAGATAGTAACTGG - Intergenic
979244947 4:118491786-118491808 ACTGCAGAACACACAGAAAAGGG - Intergenic
981749205 4:148077145-148077167 ACTGCAGACCAGACAGCTGCAGG + Intergenic
982726885 4:158915908-158915930 TCTGGGGAACAGACAGAAACAGG + Intronic
983593091 4:169436330-169436352 ACTGCGGAGCAGGCAGAAATTGG + Intronic
984149634 4:176110639-176110661 ACTGGAGAACAGACAGTAAATGG - Intronic
987600836 5:20068290-20068312 ACTGAAGACTATACAGAAAAAGG + Intronic
988184782 5:27846399-27846421 ACTGCTATCCAGGCAGAAACTGG - Intergenic
990537117 5:56733665-56733687 ACTGAAGACCAGACTGATTCTGG - Intergenic
991113435 5:62927154-62927176 ACAGCAGACTAGACAGGATCTGG + Intergenic
992149126 5:73884411-73884433 GCTGTAAACCAGACAGACACAGG - Intronic
994368651 5:98945278-98945300 ACTTCAGAGAAGACAGACACAGG - Intergenic
994745855 5:103677460-103677482 ACTGCACACCACACAGAACAGGG - Intergenic
997293859 5:132757440-132757462 AATGCAAGCCAGACAGAAAGGGG + Intronic
997527385 5:134562138-134562160 ACTGCTGACCAGACACAGATTGG + Intronic
997855042 5:137365418-137365440 ACTCCAGAACTGACAGAAGCAGG + Intronic
998362759 5:141603972-141603994 ACAGCAGAACAGGTAGAAACCGG + Intronic
999135130 5:149313633-149313655 AATGCAGTCCAAACACAAACAGG + Intronic
999239262 5:150118105-150118127 ACTTCAGAGCAGACAGGCACAGG + Intronic
999649565 5:153752011-153752033 ACTGCAGAGCCCACAGAAATGGG - Intronic
1002293875 5:178217894-178217916 TCTGAAGACCAGAAAGAAAAAGG + Intronic
1003091272 6:3105663-3105685 ACAGCAGCCCAGACAGAATGTGG + Exonic
1003303008 6:4901967-4901989 TCAGCTGACCAGACAGAAAAGGG + Intronic
1004329095 6:14705214-14705236 CATGCTGGCCAGACAGAAACAGG + Intergenic
1005948438 6:30612990-30613012 ACTGCAGAACATACAGAAGGTGG + Intronic
1008463782 6:51806785-51806807 ACTGCAGACAAGAAAGAGAAAGG + Intronic
1008482784 6:52004187-52004209 ACTGAAGAACAGAAAGAAAAGGG - Intronic
1010257984 6:73782098-73782120 ACAGAATACCTGACAGAAACAGG - Intronic
1013621326 6:111892616-111892638 ATTGGAGACCAGCCAGAAACGGG + Intergenic
1014052523 6:116971827-116971849 ATTGCAGAACAGAAAGAGACCGG + Intergenic
1016116517 6:140291616-140291638 CTTACAGACCAGACAGGAACAGG + Intergenic
1016572640 6:145532208-145532230 ACTGCAGAAAAAACAGAAAAGGG + Intronic
1018126586 6:160689066-160689088 ACTGCTGGCCAGACAGAGAAGGG + Intergenic
1020099511 7:5387218-5387240 AGTGAGGAACAGACAGAAACTGG - Intronic
1020444441 7:8254725-8254747 AGTGCAGAGAAGAGAGAAACAGG + Intronic
1020494084 7:8824940-8824962 AATGGAGACCAGACAAAAATAGG - Intergenic
1020942527 7:14559329-14559351 ACTGCAGAGCAAAAAGTAACTGG - Intronic
1023281883 7:38579207-38579229 ACTACAGAACAGCTAGAAACCGG - Intronic
1024737576 7:52322570-52322592 ACTGTATACTAGACAGAAAAGGG - Intergenic
1025967087 7:66283652-66283674 CTTGCAGGCCAGACAAAAACAGG + Intronic
1028410772 7:90528383-90528405 ACTTAAGACTAGACAGAAACAGG - Intronic
1029848517 7:103439012-103439034 ACTGCAGACCAGACACAAAGTGG - Intronic
1030539229 7:110808640-110808662 ACTGAATACTAAACAGAAACTGG + Intronic
1036534157 8:9629126-9629148 ATTGCAGGCCAGAAACAAACAGG - Intronic
1038310171 8:26440420-26440442 GCTGCACTCCAGACACAAACAGG + Intronic
1039128624 8:34234108-34234130 ACTGCAAAGCAAACTGAAACAGG - Intergenic
1039503821 8:38037068-38037090 AAGTCAGACCAGAAAGAAACAGG - Intronic
1040895602 8:52365370-52365392 ACTGCAGACCACCCTGAAAACGG + Intronic
1041349369 8:56933363-56933385 ACCACAGACCACACAGAAATAGG - Intergenic
1042182091 8:66100598-66100620 ACTGGAAACCAGGAAGAAACAGG + Intergenic
1043980595 8:86634051-86634073 ATTACAGACCAGATAGGAACAGG + Intronic
1044256413 8:90068492-90068514 ACTGAAGGCCACACAGAAATCGG - Intronic
1045523090 8:102920336-102920358 ACTCCTGACCAGTAAGAAACTGG + Intronic
1045567681 8:103338152-103338174 ACTGTAGACAAGGCAGAATCTGG + Intergenic
1046891206 8:119422924-119422946 ACTGCAGACCCCACAGAACCTGG - Exonic
1047698641 8:127428643-127428665 ACTGATGACTAGACAGAAACAGG + Intergenic
1047897814 8:129385983-129386005 ACTGTAGACCAGGGAGAGACTGG + Intergenic
1048308578 8:133300634-133300656 ACTGCTGACCAGCGAGAAAGAGG - Intronic
1048618302 8:136103715-136103737 ACTGCAGACCCAAGAGAAAAAGG + Intergenic
1054931111 9:70636309-70636331 CTTGCAGCCCATACAGAAACAGG + Intronic
1055833152 9:80406629-80406651 ACTGCAGCCCAGAGAGACACAGG + Intergenic
1057391245 9:94643086-94643108 ACTGCACACCAGGCAAATACAGG - Intergenic
1057498226 9:95576825-95576847 ATTCCAGACCAGACACCAACAGG + Intergenic
1058151504 9:101468531-101468553 ACAGAAGAGCAGACAGAATCTGG + Intergenic
1058604769 9:106708420-106708442 ACTGCAGTCCATACACCAACTGG - Intergenic
1061568144 9:131457969-131457991 ACTGCAGATCAGAGAAAAGCGGG - Intronic
1062296256 9:135828869-135828891 CCTGCAGGCCAGAGAGAAATGGG + Intronic
1062324310 9:136004979-136005001 CTTGCAGCCCCGACAGAAACCGG - Intergenic
1185731782 X:2467515-2467537 ACAGGAGACCGGACTGAAACAGG + Intronic
1189376471 X:40470458-40470480 AGTGCAGAGCAGACACAAAATGG - Intergenic
1190226376 X:48548978-48549000 ACTGTAGAGGTGACAGAAACTGG - Intronic
1193147217 X:78089867-78089889 ACCGCACTCCAGACAGAAAATGG - Intronic
1196033303 X:111114937-111114959 ACTGCAGATAAAACAGAAGCAGG - Intronic
1197666828 X:129233282-129233304 ACTCAAGACCTGAAAGAAACAGG + Intergenic
1199164335 X:144652816-144652838 ACTGCAGATCACACATCAACAGG + Intergenic
1199850860 X:151724250-151724272 ACTGAGGACCAGAGAGAAAGAGG - Intergenic
1200047652 X:153411307-153411329 AGAGCAGCCCAGACAGAAAGCGG + Intergenic
1200688050 Y:6274629-6274651 ACTGCAGACATCACAGATACAGG + Intergenic
1201047217 Y:9900073-9900095 ACTGCAGACATCACAGATACAGG - Intergenic