ID: 1125577623

View in Genome Browser
Species Human (GRCh38)
Location 15:40766226-40766248
Sequence GTGCCTGTCTGTCCTTGATG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 1, 2: 2, 3: 10, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125577623_1125577627 2 Left 1125577623 15:40766226-40766248 CCCCATCAAGGACAGACAGGCAC 0: 1
1: 1
2: 2
3: 10
4: 178
Right 1125577627 15:40766251-40766273 AGAGAAAGGTTTTTGTCGTGAGG 0: 1
1: 0
2: 2
3: 20
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125577623 Original CRISPR GTGCCTGTCTGTCCTTGATG GGG (reversed) Exonic
900247799 1:1646605-1646627 GTGCCTGTCCTTCCTTCCTGAGG + Intronic
900259026 1:1713759-1713781 GTGCCTGTCCTTCCTTCCTGAGG + Intronic
900529710 1:3146986-3147008 GTGCATGTGTGTGCTTGGTGTGG + Intronic
900797004 1:4713990-4714012 GTGCCTGCCTGCCCAAGATGAGG - Intronic
904440573 1:30526943-30526965 CTGCCTGTCTGTTCTTCAAGGGG + Intergenic
904576118 1:31506131-31506153 GTGCCTCTCTGTCTCTGTTGCGG + Intergenic
906920229 1:50056286-50056308 TTCCCTGTCTGTTCTTGTTGAGG + Intronic
907427806 1:54391887-54391909 CTGCCTGTCTGTGATTGAGGTGG - Intronic
909036562 1:70600517-70600539 GTGTCAGTCTGCCCTTGCTGGGG + Intergenic
911100074 1:94088564-94088586 GTGCCTGTGTGCCCTTTCTGTGG + Intronic
911678079 1:100682322-100682344 GTGTCAGTCTGTCCTTACTGGGG + Intergenic
912566838 1:110593392-110593414 GTGCCTGCCTGCCCTTGACTGGG - Intergenic
912726282 1:112061417-112061439 GGCCCTGTCTGTCCTTCAAGAGG - Intergenic
913233012 1:116757322-116757344 GTGCCTGCATTTCCTTCATGAGG + Intronic
920047957 1:203145818-203145840 GTGTCTGTCTGTCTCTGTTGCGG + Intronic
922921728 1:229310954-229310976 GTGCCTGTGAGGCCTTCATGGGG + Intergenic
924902589 1:248417470-248417492 CTGGATGTCTGTCCTTGATTTGG + Intergenic
1064641886 10:17423941-17423963 CTATCTGTCTGTCCTTGATGTGG - Intronic
1067385907 10:45817564-45817586 GAGCCAGTCTGTCCTGGCTGGGG - Exonic
1067449165 10:46370894-46370916 GAGCCAGTCTGTCCTGGCTGGGG + Intronic
1067635328 10:47997962-47997984 GAGCCAGTCTGTCCTGGCTGGGG - Intergenic
1070247128 10:74743440-74743462 GGGCCTGTGTGTCCTGGATGAGG - Intergenic
1071609801 10:87022108-87022130 GAGCCAGTCTGTCCTGGCTGGGG + Intronic
1075149071 10:119910198-119910220 ATGCCTGTCTGCCCTTGATGTGG + Intronic
1076304256 10:129452752-129452774 CTGCCTGGCTGTCCTTGACCTGG + Intergenic
1078986165 11:16601325-16601347 GTACCTGTCTGTGCCTGATATGG + Intronic
1079236952 11:18698007-18698029 CTGCCTGTCTGTCATTCTTGGGG + Intronic
1081875986 11:46408673-46408695 GTCTCTGTCTGTCCTCCATGTGG + Exonic
1083546622 11:63553691-63553713 CTGCCCCTCTGTCCTTGCTGGGG - Intronic
1083769747 11:64859986-64860008 GTGACTGGATGTCCTTGAAGAGG + Exonic
1083856041 11:65393685-65393707 CTGCCTGTCTGTCCTTGCCTCGG + Intronic
1084421999 11:69065168-69065190 GTGCCTGTCTGTGGGTGGTGGGG + Intronic
1084657463 11:70527767-70527789 GTGCCTGACTCTCCTTCAGGAGG + Intronic
1089639967 11:119841457-119841479 GTACCTGTCTGCCCTTGAACAGG + Intergenic
1089766326 11:120769579-120769601 GTGCATGTCTTTGTTTGATGTGG - Intronic
1090278050 11:125433236-125433258 GTGCCAGTGTGTCCGTGCTGGGG - Exonic
1090598788 11:128347908-128347930 GTGTCTTTCTGGGCTTGATGGGG - Intergenic
1091338079 11:134788003-134788025 ATGTCTGACTGTCCTTGATTTGG - Intergenic
1093998584 12:25669959-25669981 GTGCCTCTATGTACTTAATGTGG - Intergenic
1094786052 12:33848868-33848890 GTGTCAGTCTGCCCCTGATGGGG - Intergenic
1104929997 12:132333678-132333700 ATGCCTTTCTCTCCATGATGCGG - Intergenic
1105241153 13:18610409-18610431 GTGCTTGTGTGTCCCTGAGGGGG + Intergenic
1106872593 13:34037805-34037827 GGGCCTGTGTGTCCTGGAAGAGG - Intergenic
1107072841 13:36290582-36290604 CTGTGTGTCTGTCCTTGATTTGG - Intronic
1108379263 13:49840922-49840944 GTGTCTGTCTCTCCTTACTGAGG - Intergenic
1113569931 13:111346366-111346388 ATGGCTGGCTGTCCCTGATGGGG - Intergenic
1115832289 14:37356173-37356195 GTGTCAGTCTGTCCCTGCTGGGG + Intronic
1115921060 14:38373795-38373817 GTGCCTGTGTGTATTTGAGGTGG - Intergenic
1117051535 14:51865256-51865278 GTGCCTGTCTTTACTAGATCTGG + Intronic
1117079516 14:52136875-52136897 GTGTCTGTCTGCCCCTGCTGGGG - Intergenic
1118865718 14:69702066-69702088 GTGCCTGACTGTCCAAGATAAGG - Intronic
1119427777 14:74546976-74546998 GTGCCTGTCAGCCCTGGCTGAGG + Intronic
1121160297 14:91732566-91732588 TTGTGTGACTGTCCTTGATGTGG + Intronic
1125406855 15:39361676-39361698 GTGTGTGTCTGTCATTCATGTGG + Intergenic
1125577623 15:40766226-40766248 GTGCCTGTCTGTCCTTGATGGGG - Exonic
1125610926 15:40969698-40969720 TTCCCTGTCTGTCCTTGAGCGGG + Intergenic
1129954991 15:79628124-79628146 GTGCCCTTCTGTCCTTCTTGGGG - Intergenic
1132681656 16:1144896-1144918 GTCCCTGTGTGTCCTAGCTGTGG + Intergenic
1133851321 16:9506587-9506609 CTGTGTGTCTGTCCTTGATTTGG + Intergenic
1133904076 16:10004718-10004740 CTCCCTGTCTTTCCCTGATGAGG + Intronic
1133923080 16:10172073-10172095 TTGCCAGTCTTTCCTTGATGAGG + Intronic
1135534358 16:23281537-23281559 GTCCCTGGCTGTCCCTGGTGGGG + Intronic
1136992298 16:35160892-35160914 GTGTCAGTCTGCCCCTGATGGGG - Intergenic
1137620033 16:49869954-49869976 TTGCCTGTCTGTCGTTCCTGAGG - Intergenic
1137817061 16:51408462-51408484 GTGCTTATGTGTCCTTGATCAGG - Intergenic
1140077261 16:71712019-71712041 GTACCTGCCTGTCCTTGAGCAGG + Intronic
1142474926 17:183004-183026 TTACCTGTCTGTGCTGGATGGGG - Intergenic
1142820106 17:2459196-2459218 GAGCCTTTCTGTCGTTGATGAGG - Intronic
1142884037 17:2901771-2901793 GTGCCTGGCTGTCCTTGGGAGGG + Intronic
1143002122 17:3801014-3801036 TTGACTGTCTGTCTCTGATGGGG - Intronic
1144649543 17:16998448-16998470 GTCCCTGTCTTTCATGGATGGGG + Intergenic
1148614105 17:48986032-48986054 TTGCCCGTCTGTCCTGGATCCGG - Intergenic
1152246545 17:79187625-79187647 GTGCCTGTGTGTGTGTGATGGGG + Intronic
1153675242 18:7451240-7451262 GTCCCTTGCTGTCCTTCATGGGG - Intergenic
1154447805 18:14449492-14449514 GTGCTTGTGTGTCCCTGAGGGGG - Intergenic
1156162946 18:34382212-34382234 GTGTCTTTATGTCCTTCATGAGG - Intergenic
1158992320 18:62882024-62882046 GAGGCTGTCTTTCCTGGATGAGG - Intronic
1159095370 18:63895627-63895649 ATGCCTCTCTGTCATTGGTGAGG + Intronic
1159456719 18:68668825-68668847 GATCCAGTCTGTCATTGATGGGG - Intergenic
1161901127 19:7120498-7120520 CTGCCTTCCTTTCCTTGATGGGG + Intronic
1166791938 19:45403901-45403923 GTGTCTGTCTGTCCTTGAGGCGG - Intronic
925066267 2:931065-931087 GTGCCTGTCTGGCTTTAATGAGG - Intergenic
925262021 2:2537115-2537137 CTGTCTGTCTGTCCTTCCTGGGG + Intergenic
927183723 2:20467371-20467393 CAGCCTGTCTGTCCTTGACAAGG - Intergenic
927372566 2:22373767-22373789 GTGCCTGTCAGTCCTGCATTGGG - Intergenic
928022830 2:27716714-27716736 ATGCCTGTTTGCCCTTGACGGGG - Intergenic
928780097 2:34807538-34807560 GTGCCTGTGTGTGTTTGTTGAGG - Intergenic
929052665 2:37851208-37851230 GTGCTTGTCTTTTCCTGATGTGG + Intergenic
936964652 2:118115933-118115955 GATCCTGTCTGTCCTTGAGAAGG + Intergenic
937906031 2:127053288-127053310 GTGCCTGTGTGTCCTGCGTGTGG + Intronic
940900829 2:159124870-159124892 GTGCGTGCCTGTACTTGGTGAGG - Intronic
947259483 2:228204545-228204567 GTGTCAGTCTGTCCTTACTGGGG + Intergenic
948159024 2:235809082-235809104 ATGCCTGTCTGTGGTTGATTTGG + Intronic
948909889 2:240997854-240997876 CTGCCTGTCTGTCCTTCCTCAGG - Intergenic
1170570658 20:17630526-17630548 GGGCCTGTCTGTCCTGAGTGAGG - Intronic
1171466400 20:25330689-25330711 GTGTCAGTCTGCCCTTGCTGGGG - Intronic
1171850651 20:30305716-30305738 GTGCCTGTCTGTCCTTTGCCTGG - Intergenic
1173150769 20:40565010-40565032 GTGCCTGTGTGTGTTTGAGGGGG - Intergenic
1175771312 20:61626366-61626388 TTTTCTGTCTGGCCTTGATGTGG + Intronic
1176448402 21:6841173-6841195 GTGCTTGTGTGTCCCTGAGGGGG + Intergenic
1176736051 21:10548015-10548037 GAGCATGTCTGTGGTTGATGGGG - Intronic
1176826572 21:13706195-13706217 GTGCTTGTGTGTCCCTGAGGGGG + Intergenic
1177198856 21:17931045-17931067 GTTCCTGTCTGCCCAGGATGTGG + Intronic
1179367391 21:40771169-40771191 GTGGCTTTCTGTCCCTCATGTGG - Intronic
1179451082 21:41468880-41468902 GCGCCTGTGTGTCCTGGGTGGGG - Intronic
1180502090 22:15939228-15939250 GTGTCAGTCTGCCCCTGATGGGG + Intergenic
1180629132 22:17215085-17215107 GGGCCTGTGTGTCCTGGTTGAGG + Intronic
1180798166 22:18617849-18617871 GAGCCTGCCTGGCCTTGAGGAGG + Intergenic
1180981964 22:19882787-19882809 GTGCCAGTCTTTCCTGGGTGGGG - Intronic
1181223553 22:21377417-21377439 GAGCCTGCCTGGCCTTGAGGAGG - Intergenic
1181255190 22:21558205-21558227 GAGCCTGCCTGGCCTTGAGGAGG + Intronic
1182268196 22:29135807-29135829 TGGCCTGACTCTCCTTGATGGGG + Intronic
1184756285 22:46517634-46517656 CTTCCTGTCTGTCCTGCATGTGG - Intronic
1185043333 22:48516834-48516856 GTGCCAGGCAGTGCTTGATGGGG + Intronic
950475844 3:13214376-13214398 GTGCCTGCCTGTGCTGGCTGTGG - Intergenic
951592380 3:24280312-24280334 GTGTCAGTCTGTCCCTGCTGGGG - Intronic
952525672 3:34208049-34208071 TGGCCTGTCTGTGCTTGATTCGG + Intergenic
952960161 3:38584027-38584049 GTACCTGTCTGTCCTTGGGCAGG - Intronic
956563944 3:70614876-70614898 GTACCAGTGTGTCCTGGATGTGG - Intergenic
962102051 3:132352902-132352924 GTGCCTGTTTGTCTTTGATTTGG + Intronic
963602885 3:147392653-147392675 GCGCCTGTTTTTCCTGGATGCGG - Intronic
966872973 3:184303810-184303832 GTGCCTCTCTTTCACTGATGAGG + Intronic
970225426 4:13852014-13852036 GTGTCTCTCTGTCCTTTAGGGGG + Intergenic
973706216 4:53583347-53583369 GTGTCTGTGTGTGCATGATGGGG + Intronic
973800403 4:54471919-54471941 GTGCCTGTCTTTTAGTGATGTGG + Intergenic
976985350 4:91288860-91288882 GTTCCTGGCTGTCACTGATGTGG - Intronic
977765031 4:100787177-100787199 GTGCCTGTCTGTCCTTGGTGAGG + Intronic
980231468 4:130051591-130051613 GTGCCAGTCTGCCCTTACTGGGG + Intergenic
983040607 4:162921257-162921279 GTGGCTGTCTCATCTTGATGTGG - Intergenic
985017576 4:185652429-185652451 GTGCCTGGTTGTCCTCCATGGGG + Intronic
987207419 5:15641745-15641767 CTGCCTGACTGTCTTTGATCTGG + Intronic
987870867 5:23614999-23615021 CTGCCTGTCTGCCCCTGTTGAGG - Intergenic
992622890 5:78610955-78610977 GTGCCTGTGGCTCCTTGAGGAGG - Intronic
993334932 5:86645563-86645585 GTGCCAGTATGCCCTGGATGTGG + Intergenic
995964585 5:117889213-117889235 GTGCATGTTTCTCCTTGATTTGG + Intergenic
997087502 5:130818474-130818496 GTGCCAGTCTGCCCCTGCTGGGG - Intergenic
1003527617 6:6911156-6911178 GTCCCGGTGTGTCCTTCATGTGG + Intergenic
1004101060 6:12611957-12611979 GTGTCTGTCTGTCTTTTCTGGGG - Intergenic
1005680829 6:28206789-28206811 GTGTCTGTTTGCCCTTGTTGAGG - Intergenic
1008660115 6:53659164-53659186 ATGACTGTTTGTCCATGATGTGG - Intronic
1010196990 6:73249645-73249667 TTGCCTGTCTCTGCTGGATGTGG + Intronic
1011093733 6:83635262-83635284 GTGGCTGTCTGTCTTTTATTAGG + Intronic
1016962138 6:149684130-149684152 ATGCCTCTCTGTCCTTGATTAGG + Exonic
1018826384 6:167410492-167410514 GTGACTGTCTCTGCTGGATGGGG - Intergenic
1019528357 7:1491334-1491356 AAGCCTGTCTTTCCCTGATGAGG - Intronic
1021394722 7:20133090-20133112 GTGCCCCTGTGGCCTTGATGGGG + Intergenic
1021946594 7:25733811-25733833 GTGTCTGGGTGTCCTTGATGGGG - Intergenic
1022344004 7:29496162-29496184 AGGCCTGTCTGTGCTTAATGGGG + Intronic
1027797523 7:82713206-82713228 CTGTCTGCCTGTCCTTGATTTGG + Intergenic
1029252813 7:99249210-99249232 CTGCCTGTCTGTCCTAGCTAGGG + Intergenic
1031527115 7:122835031-122835053 GTGTCTGTCTGTCCCTCCTGGGG - Intronic
1031931722 7:127692510-127692532 CTGCCTGGCTGTCCTTTGTGTGG + Intronic
1033567717 7:142595689-142595711 GTTCATGTCTATCCTTAATGAGG - Intergenic
1037765273 8:21768733-21768755 GAGCTGGTCTGTCCTTGGTGTGG - Intronic
1041111440 8:54486623-54486645 ATGCCTTTCTGTCTTTGATAGGG + Intergenic
1043547415 8:81331120-81331142 GTGTCAGTCTGTCCCTGCTGGGG + Intergenic
1045405738 8:101865085-101865107 GTGCATGTCTGTCCATGATCAGG - Intronic
1047206356 8:122805426-122805448 GTACCTGTGTTTCCTTGCTGGGG - Intronic
1047878524 8:129167594-129167616 GTCCCTTTCTGTCCTAGCTGAGG + Intergenic
1048096406 8:131300247-131300269 GTGCCAGTGTGCCCTGGATGTGG - Intergenic
1048626878 8:136195461-136195483 GTGTCAGTCTGTCCCTGCTGGGG + Intergenic
1048848766 8:138624302-138624324 GTTCATTTCTGTCCTTGAAGTGG + Intronic
1049189471 8:141278939-141278961 TTGCTTGTCTGGCCTTGAAGGGG - Intronic
1049212451 8:141392906-141392928 GTGCCTTTCTGTCTTGGCTGAGG - Intronic
1050093934 9:2044105-2044127 ATGCCTGTCTGTCCCTCAGGCGG - Intronic
1051041916 9:12821691-12821713 GTGCCTGTGAGTCCTCTATGAGG - Exonic
1051258981 9:15243332-15243354 GTGCTTTTCTGTCCTCAATGGGG + Intronic
1051510999 9:17877850-17877872 GAGCCTGACTGTCCTGGCTGTGG - Intergenic
1053239298 9:36483451-36483473 GTGCCTGTTTGTCTTTGTTAAGG - Intronic
1053426069 9:38010929-38010951 GGGCCTGTTTGTCCTTCCTGTGG - Intronic
1055835235 9:80432026-80432048 GTGCCTGGCTGTCATTCTTGTGG + Intergenic
1056114908 9:83432423-83432445 GTGACTGTGTGTCCTTTGTGTGG + Intronic
1057796414 9:98161159-98161181 GTGGCTGCCTGTGCTTGGTGTGG + Intronic
1059367377 9:113797134-113797156 GTGCCTGGATGTCCCTGGTGGGG + Intergenic
1059709006 9:116850151-116850173 GTGCCTTGCTGGCCTTGCTGTGG - Intronic
1059950527 9:119457446-119457468 GTTCCTTCCTGGCCTTGATGTGG - Intergenic
1062067853 9:134538383-134538405 GGGCCTGGCTGTCCTTTGTGGGG + Intergenic
1062367999 9:136221071-136221093 GTGCCTGTGTGCCCCTCATGAGG - Intronic
1062368008 9:136221118-136221140 GTGCCTGTGTGCCCCTCATGAGG - Intronic
1062368033 9:136221212-136221234 GTGCCTGTGTGCCCCTCATGAGG - Intronic
1203520789 Un_GL000213v1:43345-43367 GTGCTTGTGTGTCCCTGAGGGGG - Intergenic
1188238724 X:27759305-27759327 GTGTCAGTCTGTCCCTGCTGTGG - Intergenic
1189381996 X:40508619-40508641 GAGCCTGGCTGTCATTGTTGTGG + Intergenic
1191827325 X:65379332-65379354 GTGTCCGTCTGCCCTTGCTGGGG - Intronic
1192209127 X:69116341-69116363 GTGCCTGCATGTCCATGGTGAGG - Intergenic
1192704210 X:73511785-73511807 GTGTCAGTCTGTCCCTGCTGGGG - Intergenic
1193045301 X:77046966-77046988 GTGTCAGTCTGCCCTTGCTGTGG - Intergenic
1198152132 X:133921874-133921896 GTGCCTGTCTCTCCTGGTTAGGG + Intronic
1199016254 X:142819586-142819608 GGGCCTGTGCCTCCTTGATGGGG - Intergenic
1199894458 X:152117511-152117533 GTGCCTGTCTGTCATTCCTGGGG + Intergenic
1200879179 Y:8194203-8194225 GTGTCAGTCTGCCCCTGATGGGG - Intergenic
1201635625 Y:16119972-16119994 GTGTCAGTCTGTCCCTGCTGGGG + Intergenic