ID: 1125579516

View in Genome Browser
Species Human (GRCh38)
Location 15:40775544-40775566
Sequence CAGGCTCACCTTTAGTTTGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125579504_1125579516 26 Left 1125579504 15:40775495-40775517 CCTGCTGAGGGGAGGCGGTGTGA 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1125579516 15:40775544-40775566 CAGGCTCACCTTTAGTTTGGGGG 0: 1
1: 0
2: 0
3: 20
4: 153
1125579508_1125579516 -8 Left 1125579508 15:40775529-40775551 CCCACAGATCCTGCCCAGGCTCA 0: 1
1: 0
2: 2
3: 36
4: 282
Right 1125579516 15:40775544-40775566 CAGGCTCACCTTTAGTTTGGGGG 0: 1
1: 0
2: 0
3: 20
4: 153
1125579509_1125579516 -9 Left 1125579509 15:40775530-40775552 CCACAGATCCTGCCCAGGCTCAC 0: 1
1: 1
2: 3
3: 34
4: 433
Right 1125579516 15:40775544-40775566 CAGGCTCACCTTTAGTTTGGGGG 0: 1
1: 0
2: 0
3: 20
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125579516 Original CRISPR CAGGCTCACCTTTAGTTTGG GGG Exonic
901418884 1:9136928-9136950 CAGACTCACCCTTAATCTGGAGG - Intergenic
903818579 1:26083347-26083369 CAGGTTCACCTGGGGTTTGGAGG - Intergenic
905464762 1:38144517-38144539 CAGGCCCACCCTTAATTGGGTGG + Intergenic
905672841 1:39803620-39803642 TAGGTTCACCTAGAGTTTGGAGG - Intergenic
908114451 1:60927264-60927286 AAGGCACACATTGAGTTTGGGGG - Intronic
911290442 1:96051056-96051078 CAGGCCCACCTTTCCTTTAGGGG + Intergenic
912569538 1:110611285-110611307 GAGGCTGACCTTGACTTTGGAGG - Intronic
912599885 1:110919272-110919294 CAGACCCACCTTTAATCTGGTGG + Intergenic
912733775 1:112132463-112132485 CAGACCCACCCTTAATTTGGGGG - Intergenic
913386878 1:118267393-118267415 CAAGGTCACCTTTGGTCTGGTGG + Intergenic
916343839 1:163766264-163766286 GAAGCTCACATTTATTTTGGGGG - Intergenic
917505531 1:175623812-175623834 CAGGCTCCTCTGTAGTATGGGGG - Intronic
918184042 1:182111609-182111631 GAGGCTCACCTGGAGTTGGGCGG + Intergenic
921543841 1:216450856-216450878 CAGGCACAGCTTTGGTTTGTGGG - Intergenic
923006179 1:230051848-230051870 CAATCTCACCTTTAATTTGCTGG + Intergenic
923234164 1:232016053-232016075 CAGGCACCCCTGTAGTTTGCTGG - Intronic
923976804 1:239273236-239273258 CAGGCTCTCTTTTAGATTGGAGG - Intergenic
924846149 1:247774255-247774277 CAGGCTCATGTTTCTTTTGGAGG - Intergenic
1063238072 10:4139967-4139989 CAGGCCCACCCTTAATATGGTGG + Intergenic
1064540887 10:16403907-16403929 CAGGCTCAGTTCTAGTTTAGGGG + Intergenic
1064837906 10:19555264-19555286 CAGGCTCACCTTTAACATTGGGG + Intronic
1065523950 10:26598753-26598775 CAGGCTCAGTTTTAGATTGGAGG + Intergenic
1065526228 10:26623806-26623828 CAGGCTCAATTTTAGATTGGAGG + Intergenic
1065531778 10:26677316-26677338 CAGGCTCAATTTTAGATTGGAGG + Intergenic
1065596505 10:27318564-27318586 CAGGGTCAATTTTAGATTGGAGG - Intergenic
1066699689 10:38113741-38113763 CAGTCTCAACTCTACTTTGGTGG + Intronic
1070436371 10:76397592-76397614 TGGGCTAACCTTGAGTTTGGAGG + Intronic
1070976596 10:80610328-80610350 CAGGCTCACATTCAGGTGGGAGG - Intronic
1072964377 10:99958508-99958530 CAGACTCACTTTCATTTTGGAGG - Intronic
1076388727 10:130079700-130079722 CATGCTCACAAGTAGTTTGGTGG + Intergenic
1078132196 11:8622023-8622045 CAGGCCCACCCTTAATTGGGTGG + Intronic
1080028873 11:27639922-27639944 CAGGCTCACCAGTTGTTTGTTGG + Intergenic
1081589913 11:44414982-44415004 CAGACTCACCTTTAATCTGATGG + Intergenic
1083094170 11:60232935-60232957 CAGTTTCAACTTGAGTTTGGAGG - Intronic
1086952550 11:92905724-92905746 GAGGCTCACATTTAAATTGGTGG - Intergenic
1088774266 11:113067114-113067136 CAGCCTCTCCTGTAGTGTGGTGG - Intronic
1090864991 11:130691891-130691913 CAAACTCACCTTTATTTTTGTGG + Intronic
1091461164 12:644229-644251 CAGGCCCACATTTAGGTTTGAGG - Intronic
1097077317 12:56404874-56404896 CAGACCCACCTTTAATTTGGTGG + Intergenic
1098399092 12:70054277-70054299 CAGGCTTACCTTTAGCTATGGGG + Intergenic
1098718309 12:73860851-73860873 CAGACCCACCCTTAGTCTGGTGG - Intergenic
1100082877 12:90874582-90874604 CAGACCCACCCTTAGTCTGGTGG + Intergenic
1101535185 12:105610002-105610024 CAGACCCACCCTTAATTTGGTGG - Intergenic
1107549361 13:41460124-41460146 CGGACTAACCCTTAGTTTGGTGG + Intronic
1108633809 13:52312995-52313017 CAAACTCAACTTTTGTTTGGAGG + Intergenic
1110119981 13:71867613-71867635 CAGGCTCCTCTTTAAGTTGGCGG - Intergenic
1110754906 13:79161497-79161519 CAGGCTTACTTATAGTATGGAGG + Intergenic
1115541007 14:34421326-34421348 CAGGGTCACCTTTAGCTTTGAGG - Intronic
1117444775 14:55793625-55793647 CAGGTTGTCCTTTTGTTTGGGGG - Intergenic
1118880542 14:69822170-69822192 CAGACTCACCCTTAATCTGGTGG - Intergenic
1119060198 14:71465976-71465998 CAGGCCCACCTTTAATCTGGTGG - Intronic
1119060994 14:71474328-71474350 CAGAATCACCGTCAGTTTGGAGG - Intronic
1119593267 14:75909984-75910006 CAGCCTGGCTTTTAGTTTGGGGG + Intronic
1120606411 14:86583882-86583904 CAGGCTGACCTTTAGGGTGGAGG + Intergenic
1122170075 14:99865633-99865655 CTGGCTCACCTTTTGGTTGCTGG - Exonic
1125579516 15:40775544-40775566 CAGGCTCACCTTTAGTTTGGGGG + Exonic
1127705289 15:61540878-61540900 CAGACTCACCCTTAATCTGGTGG + Intergenic
1128067816 15:64775477-64775499 CAGGGTCACATCAAGTTTGGCGG + Exonic
1132611475 16:818464-818486 CTGGCTCACCTAGAGTTGGGGGG + Intergenic
1134655522 16:15945659-15945681 TAAGCTCACCTTTCTTTTGGAGG + Intergenic
1135804218 16:25527442-25527464 TAGGATGACCTTTAGTTTTGTGG + Intergenic
1139267963 16:65657329-65657351 CAGGCTCCCATTTAATTTGGAGG - Intergenic
1139665704 16:68454011-68454033 CAGGCTCACCTTCCTCTTGGTGG - Intergenic
1140041880 16:71413560-71413582 CAGGCCCACCTCTGGGTTGGAGG - Intergenic
1141651322 16:85394610-85394632 CAGGATCACCTTGAGATTGCAGG + Intergenic
1143796065 17:9337827-9337849 CTGGCTTTCCTTTATTTTGGTGG - Intronic
1145866401 17:28244707-28244729 CAGGCTGGCCTTGGGTTTGGTGG - Intergenic
1146546534 17:33743566-33743588 GAGGCTCACCTGTATTATGGAGG - Intronic
1146637766 17:34518861-34518883 CAGGCTCAGCCCAAGTTTGGGGG - Intergenic
1156395210 18:36693161-36693183 CAGGCTCCTCTTTCGTTTGACGG + Intronic
1159849920 18:73515352-73515374 CAGGCCCACCCTTACTCTGGGGG + Intergenic
1161909819 19:7184841-7184863 CAAGCTCACCAATGGTTTGGAGG - Intronic
1163827120 19:19529976-19529998 CAGGCTCATGTTGAGTTTTGGGG + Intronic
1164818736 19:31227493-31227515 CAGGCTCTCCCTAAGTTTGGTGG - Intergenic
1167476220 19:49702773-49702795 CAGGGTCAGCTTTGGTGTGGGGG + Intronic
1168390318 19:56001664-56001686 CAGGCTGATTTTTACTTTGGTGG + Intronic
930121285 2:47763085-47763107 CAGACTCACCCTTAATCTGGTGG - Intronic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
936086667 2:109474047-109474069 CCTCCTCACCTTTGGTTTGGGGG + Intronic
937843521 2:126552135-126552157 CAGACCCACCCTTAATTTGGTGG - Intergenic
938970000 2:136423379-136423401 CAGACTCACCTTTAACTTTGGGG - Intergenic
941511250 2:166413693-166413715 CAGACCCACCTTTAATCTGGTGG + Intronic
942811786 2:180008494-180008516 CAGACTCACCCTTAATCTGGTGG + Intergenic
943749955 2:191500915-191500937 CAGGTTCACCTTTCGTTGTGTGG - Intergenic
945452127 2:210005712-210005734 CAGCCTCACCTTTAGTCATGTGG + Intronic
946391199 2:219418038-219418060 GAGGCTTCCCTTTAGTTTGAGGG - Intergenic
947109822 2:226706882-226706904 GAGGCTCAACTTTAGTCTAGTGG - Intergenic
948041911 2:234908854-234908876 CATGATCACCTTTTGTTTTGAGG + Intergenic
1169245390 20:4020630-4020652 CAGACTCACTTTTAGATTGGAGG + Intergenic
1171355756 20:24544386-24544408 CAGGCTTTCCGTCAGTTTGGTGG + Intronic
1172606044 20:36214786-36214808 CAGCCTCACCTTCAGAGTGGAGG - Intronic
1173846785 20:46193413-46193435 CAGGCTCAGCTTTGGGCTGGAGG - Intronic
1175340740 20:58227764-58227786 CAGGCTTGCCTTGGGTTTGGGGG + Intronic
1178701643 21:34838726-34838748 CAGTCTAACCTTTAGGTTGCAGG + Intronic
1179596624 21:42446956-42446978 CAGGCACACCTCTACTTTGGAGG - Intronic
950264421 3:11563669-11563691 CACGCTCAGTTTTAGTCTGGAGG - Intronic
951669037 3:25159904-25159926 CAGACACATCTTTATTTTGGGGG + Intergenic
953225508 3:41015599-41015621 CTTACTCACCTTTAATTTGGTGG - Intergenic
953556637 3:43951366-43951388 CAGGCACAACTGAAGTTTGGAGG + Intergenic
955506372 3:59637006-59637028 GGGGCTGACCTTTAGTTTGGAGG + Intergenic
959635353 3:108561052-108561074 CAGCTTCACCTCTGGTTTGGAGG + Intronic
962899093 3:139742060-139742082 CAGGTTCACTTTTTTTTTGGTGG + Intergenic
964824410 3:160809394-160809416 AAGGCTCAACTTTAGTTTTCAGG + Intronic
968753146 4:2400807-2400829 CAGGCCCACCCTTAATCTGGTGG - Intronic
970534814 4:17019919-17019941 CAGACCCACCCTTAATTTGGTGG + Intergenic
971046730 4:22813380-22813402 CAGACCCACCTTTAATTGGGTGG + Intergenic
973246490 4:48016292-48016314 CAGGCTCAAGTTTATTTTGGGGG - Intronic
976602565 4:86951284-86951306 CTGGCTGACCTTTAGGCTGGGGG - Intronic
976949537 4:90812246-90812268 CAGACTCACCCTTAATCTGGGGG - Intronic
979493624 4:121359367-121359389 CAGACCCACCTTTAATCTGGTGG + Intronic
981064792 4:140471039-140471061 CAGGCTCGGCTTAATTTTGGGGG + Intronic
981946928 4:150358365-150358387 CAGGCTCACCATTACTTGGAAGG + Intronic
982851711 4:160325683-160325705 CAGACTCACCCTTAATTTGGTGG - Intergenic
984733285 4:183088254-183088276 AAGTCTCTCCTTTAGTTTGGTGG - Intergenic
985335621 4:188890316-188890338 CAGACCCACCTTTAATCTGGTGG - Intergenic
986294629 5:6427565-6427587 CAGGCTCAAAGTGAGTTTGGAGG - Intergenic
986742528 5:10716507-10716529 CAGACTCACCCTTAATTGGGTGG + Intronic
988204989 5:28122839-28122861 CAGACCCACCTTTAATCTGGTGG - Intergenic
990933876 5:61125705-61125727 CAGGCTTACCTTTCATTTTGGGG - Intronic
991565810 5:68003171-68003193 CAGGCCCACCTAGGGTTTGGTGG + Intergenic
991946462 5:71902605-71902627 CAGACTCACGTTTAATCTGGTGG + Intergenic
992339004 5:75802859-75802881 CAGGTTCACCCTTAATCTGGTGG + Intergenic
992736242 5:79724426-79724448 AAGGCTCCCCTTTCATTTGGAGG - Intronic
994222426 5:97211333-97211355 CAGACCCACCTTTAATCTGGTGG - Intergenic
997179551 5:131814097-131814119 CAGACTCACCCTCAATTTGGTGG - Intronic
1000030893 5:157400151-157400173 CAGGCTGATCTTTAGCATGGAGG + Intronic
1000770727 5:165350598-165350620 CAGGCTGAATTTCAGTTTGGGGG - Intergenic
1001734107 5:173984749-173984771 AAGGCTCACTTATATTTTGGAGG - Intronic
1002993777 6:2263704-2263726 CAGTGTCAGCTTTAGTTTGCTGG + Intergenic
1005979819 6:30828345-30828367 CTGGCTCCCCTTTACTATGGGGG + Intergenic
1008536592 6:52510692-52510714 CAGGTTCACTCTGAGTTTGGAGG + Intronic
1013014551 6:106149495-106149517 CTGGCTTCACTTTAGTTTGGGGG + Intergenic
1014926552 6:127277730-127277752 CAGACTCACCCTTAATCTGGTGG - Intronic
1015376586 6:132516789-132516811 CAGGCCCACCCTTAATCTGGTGG + Intergenic
1017221284 6:151968782-151968804 CAGGCACACCTTCAGGCTGGTGG + Intronic
1017494945 6:154975416-154975438 CCGGATCACCTTTAGATTGAAGG - Intronic
1017558734 6:155604072-155604094 CAGACTCACCCTTAATTTGGTGG - Intergenic
1017610665 6:156183006-156183028 AAAGCTCACCTTTGGTTTGTAGG - Intergenic
1019927483 7:4202880-4202902 CAGGTTCACCTTGGGTCTGGTGG + Intronic
1023043829 7:36194784-36194806 TTGCCTAACCTTTAGTTTGGAGG + Intronic
1023375390 7:39550452-39550474 AAGGTTAACCTTTAGTTTTGTGG + Intergenic
1023520949 7:41049465-41049487 CAGGCTCCCCTTCAGATTGAAGG - Intergenic
1024115063 7:46185044-46185066 CAGGCACTTCTTTATTTTGGAGG + Intergenic
1030598333 7:111564893-111564915 CAGACCCACCTTTAATTGGGTGG - Intergenic
1031061481 7:117056094-117056116 CAGACTCACCCTTAATCTGGTGG - Intronic
1032173464 7:129605249-129605271 CAGACTCACTTTTAGCTTGCTGG - Intergenic
1032349752 7:131149848-131149870 CAGGTTGACCTTTAGTTTGCTGG + Intronic
1032598444 7:133266953-133266975 GAAGCTCAGATTTAGTTTGGGGG + Intronic
1033522963 7:142181359-142181381 CAGGCACCCTTTTTGTTTGGTGG + Intronic
1033637090 7:143222126-143222148 CAAGGTCACCTTCACTTTGGTGG + Exonic
1034398772 7:150847717-150847739 CAAGGTCACCTTCAGTATGGAGG + Intronic
1039395497 8:37222169-37222191 CAGCCTACCCTTTAGTTAGGTGG + Intergenic
1040838541 8:51758973-51758995 CAGTATCACCTTTTGTTTTGAGG + Intronic
1044861048 8:96524318-96524340 ATGGCTGACCTTTCGTTTGGGGG + Intronic
1050165726 9:2763077-2763099 CAGTCTCCCCATAAGTTTGGAGG + Intronic
1052495013 9:29213899-29213921 GGGGCTCATCTTTAGTCTGGTGG - Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1056527542 9:87457239-87457261 CAGGCTGAGCTTCAGTTTGGAGG + Intergenic
1056896485 9:90555438-90555460 CATACTCTCCTTTAGTTTGATGG - Intergenic
1058939448 9:109799478-109799500 AGGGGTCACCTTTAGTTTTGGGG + Intronic
1060051607 9:120382425-120382447 CAGCCTCACCTTTAAGGTGGGGG - Intergenic
1062500865 9:136851457-136851479 CAGGCTCACGTTGACTCTGGAGG + Intronic
1186368414 X:8920417-8920439 CAGACCCACCATTAATTTGGTGG + Intergenic
1187245964 X:17553121-17553143 TAGGCTCTGCCTTAGTTTGGTGG - Intronic
1193928017 X:87514626-87514648 CAGACCCACCCTTAGTCTGGTGG + Intergenic
1197404639 X:126035065-126035087 CAGACTCACCCTTAGTTGGGTGG + Intergenic
1198468991 X:136928794-136928816 CTGGCTCACCTTTACCTTGAGGG + Intergenic
1200051037 X:153431909-153431931 CTGGATTCCCTTTAGTTTGGGGG - Intergenic