ID: 1125581218

View in Genome Browser
Species Human (GRCh38)
Location 15:40787408-40787430
Sequence ACTGAGGAGCAGAAGGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 759
Summary {0: 1, 1: 0, 2: 3, 3: 65, 4: 690}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125581212_1125581218 23 Left 1125581212 15:40787362-40787384 CCAAAACACAATCGGAAACCTCA 0: 1
1: 0
2: 0
3: 6
4: 115
Right 1125581218 15:40787408-40787430 ACTGAGGAGCAGAAGGAAGTAGG 0: 1
1: 0
2: 3
3: 65
4: 690
1125581213_1125581218 5 Left 1125581213 15:40787380-40787402 CCTCAACTATGTCAATTACTTCA 0: 1
1: 0
2: 1
3: 12
4: 152
Right 1125581218 15:40787408-40787430 ACTGAGGAGCAGAAGGAAGTAGG 0: 1
1: 0
2: 3
3: 65
4: 690

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125581218 Original CRISPR ACTGAGGAGCAGAAGGAAGT AGG Intronic
900416084 1:2535426-2535448 CCTGAGGAGCTGAGGGAGGTGGG + Intergenic
900507760 1:3038254-3038276 ACTGATGTGCAGACGGAGGTAGG - Intergenic
900694560 1:4001780-4001802 AGTGAGGAGTGGAAGGGAGTGGG + Intergenic
900753041 1:4411762-4411784 ACTGAGGGGCATAAGGCAGAGGG + Intergenic
900801359 1:4738933-4738955 ACTTAGGAGGAGAAGGAGGTGGG + Intronic
900868906 1:5287977-5287999 ACCGAGTAGCAGAAGGAGGAAGG - Intergenic
901019323 1:6247987-6248009 CCTGAGGGCCAGAAGGAACTGGG + Exonic
901182628 1:7352125-7352147 AAGGAGGAGGAGAAGGAAGCAGG + Intronic
901626739 1:10629198-10629220 GCTGAGGATCAGAAGGAAGCAGG + Intronic
901748673 1:11392141-11392163 AGAGAGGAGCAGAATGAAGAAGG - Intergenic
901780438 1:11590636-11590658 AATGAGGTGCAGGTGGAAGTGGG + Intergenic
902228734 1:15013815-15013837 ACTGAGGAGCTGAAGGAGGCAGG + Intronic
902360047 1:15937418-15937440 ACAGGGGAGGGGAAGGAAGTCGG - Exonic
902736334 1:18403738-18403760 ACTGAGGAGGTGAAGTCAGTAGG - Intergenic
903065832 1:20698883-20698905 ACTGAGAAGAAAAAGCAAGTAGG + Intronic
903651768 1:24926939-24926961 CTTGAGCAGCAGAAGGAAGGCGG - Intronic
904000421 1:27335612-27335634 ACTGAGGACCAGCATGAAGTGGG + Exonic
904573041 1:31482058-31482080 GCTGAGGAGGAGGAGGAAGAGGG - Intergenic
904961141 1:34333946-34333968 GCTGAGGTCCAGAAGGCAGTGGG - Intergenic
905051894 1:35058911-35058933 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
905207893 1:36353318-36353340 ACCCAGGACCAGCAGGAAGTGGG - Intronic
905244909 1:36606052-36606074 ACAGAGAAGCAGATGGAAGGAGG + Intergenic
905589354 1:39149085-39149107 AATGAGGATCAGAAGGGAGAGGG + Intronic
905707154 1:40069281-40069303 ACTGAGGAGGTGGGGGAAGTAGG + Intronic
906111768 1:43328589-43328611 GCTTAGGACTAGAAGGAAGTTGG + Intergenic
906269109 1:44460405-44460427 GCTGTGGAGCAGTAGGAAATTGG + Intronic
906350952 1:45058807-45058829 AAGTAGGAGGAGAAGGAAGTGGG + Intronic
906708081 1:47909540-47909562 AAGGAGGAGAAGAAGGAAGAAGG + Intronic
906784882 1:48606548-48606570 ACTGAGGAACAGAGGCAAGAAGG - Intronic
907321692 1:53606643-53606665 AAAGAGGAGCAGCAGGAAGGTGG + Intronic
907386768 1:54130812-54130834 ACTGAGCCACAGAAGGAAATGGG + Intergenic
908176618 1:61562076-61562098 ATTGAAGACCTGAAGGAAGTAGG + Intergenic
908275921 1:62470977-62470999 ACGGAGGAGGATAAAGAAGTGGG - Intronic
908879620 1:68716076-68716098 ACTGAGGGGCTGAGGGAAGCTGG - Intergenic
909099781 1:71336210-71336232 ACTGAGGGGCAGAAGTTAGAAGG + Intergenic
909538083 1:76760625-76760647 CCTGGGGAGCAGAGGGAAGTGGG + Intergenic
909875663 1:80799419-80799441 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
909991035 1:82222716-82222738 AATGAGGAGCAGAATGGAGCTGG - Intergenic
910068131 1:83178351-83178373 CCTGAGGAGGGGAAGGAAGATGG + Intergenic
910734351 1:90435837-90435859 ACTGAATAGCAGAAGCAAGAAGG + Intergenic
910821759 1:91358350-91358372 ACTGAGAAGGAAAAGAAAGTTGG + Intronic
910892069 1:92028872-92028894 GCTGAGGAGGAGAAAGAAGAAGG - Intergenic
911739533 1:101371796-101371818 ACTAAGGTGCAGAAGCCAGTAGG - Intergenic
911854469 1:102859360-102859382 ACTGAGGGGCAGAAAGCAGAAGG - Intergenic
912259967 1:108100748-108100770 ACTGAGTAACAGAAGCAAATCGG - Intergenic
913295979 1:117320908-117320930 ACTGAGGGGCAGGAGAAGGTTGG - Intergenic
913367066 1:118050379-118050401 ACTGAGGGGCATAAGGCAGAAGG - Intronic
913705651 1:121419482-121419504 ACAAAGGAGGAGAAGGAAGGAGG - Intergenic
914096002 1:144544760-144544782 ACGGAGGAGCTGAGGCAAGTAGG + Intergenic
914302522 1:146389205-146389227 ACGGAGGAGCTGAGGCAAGTAGG - Intergenic
915379389 1:155426907-155426929 CCTGGGGATCAGAAGGAAATTGG - Intronic
915587876 1:156854128-156854150 ACGGAAGAGCAGCAGGTAGTCGG + Exonic
915835690 1:159173069-159173091 TCTGTGGAGCAAAGGGAAGTGGG + Intronic
916036333 1:160925879-160925901 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
916567180 1:165991093-165991115 AATGAGGAGGAGAATGAAGAAGG + Intergenic
917098036 1:171418990-171419012 ACTGGGGAGGAGGAGGAAATGGG + Intergenic
917310171 1:173670262-173670284 CCTTAGGAGCAGAAGAAACTTGG + Intergenic
917521145 1:175749382-175749404 AATGAGGAGCAAAAGGAACCTGG + Intergenic
917902358 1:179555356-179555378 ACTGAGAAGCAGGAGGAAACTGG - Intronic
918226589 1:182489139-182489161 ACTGAGGACCTGAAGCAAGGAGG + Exonic
919159329 1:193807898-193807920 TATGTGGAGCAGAAGGAAGATGG + Intergenic
919676623 1:200389894-200389916 AATGAGGAGCAGAATGATGATGG - Intergenic
919975345 1:202607140-202607162 CCTGAGGAGCAGAAAGAGCTTGG - Intronic
920465799 1:206184018-206184040 TCTGAGTAGCAGGAGAAAGTGGG - Intergenic
921081245 1:211739911-211739933 AGTGGGTATCAGAAGGAAGTGGG - Intergenic
921094758 1:211876668-211876690 ACTGGGAAGCAAAAAGAAGTAGG + Intergenic
921990457 1:221360437-221360459 ACTGGGGAGGAGAAGGAATCAGG - Intergenic
922153200 1:223022357-223022379 CCTGGGCAGCAGAAGGAAGGTGG + Intergenic
922464983 1:225840314-225840336 ACTGAGAAGCAGAGGGATGGAGG + Intronic
922546765 1:226463926-226463948 ACTGGGGAGCAGATGGTAGAAGG + Intergenic
922663446 1:227449452-227449474 ACTGACGGGCAGAAGGCAGAAGG + Intergenic
923257894 1:232237186-232237208 TCTGAGGAGCAGAAGGGATTTGG + Intergenic
923796981 1:237166238-237166260 TCAGAGAAGCAGATGGAAGTTGG - Intronic
924057473 1:240138171-240138193 TCTCAGGAGCAGTAGGAAGCCGG + Intronic
924066347 1:240226356-240226378 AATGAAGACCAGAAGGCAGTAGG + Intronic
924515204 1:244760220-244760242 CCTGAGAAGCAAAAGGAACTGGG + Intergenic
924750914 1:246888799-246888821 ACTCAGGAGGATAAGGAAGGAGG + Intronic
1062781121 10:208769-208791 AATGAGGTGGAGAAGGAAGAAGG + Intronic
1062902284 10:1155595-1155617 GCTGGGGAGCCGGAGGAAGTGGG + Intergenic
1063701674 10:8390459-8390481 ACTCAGCAACAGAAGAAAGTGGG - Intergenic
1065251641 10:23821534-23821556 CTTGAGAAGCAGAAGGAAGCAGG + Intronic
1065640351 10:27776071-27776093 ACTGAGGGGCATAAGGCAGAGGG + Intergenic
1065992397 10:31025180-31025202 AAGGAGGAACAGAAGGAAGGAGG + Intronic
1066084421 10:31962485-31962507 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1067150030 10:43724189-43724211 TCTGAGGAGCTAAAAGAAGTTGG + Intergenic
1067150370 10:43728017-43728039 AATGGGGAACAGAAGGCAGTGGG + Intergenic
1067789743 10:49278650-49278672 ACTGGGGAGCAGGAGGGAGGTGG + Intergenic
1067954910 10:50780411-50780433 ACTGAGGGGCATAAGGCAGAAGG + Intronic
1069174319 10:65271342-65271364 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1069755282 10:70771049-70771071 ACTGAAGGGCAGATGGCAGTTGG - Intergenic
1069893215 10:71664835-71664857 AGGGAGGAGGAGAAGGAAGAGGG - Intronic
1070398366 10:76032223-76032245 ACCCAGGAGCAGAAGGGACTGGG + Intronic
1070541814 10:77420903-77420925 AATGAGGGGCAGAACTAAGTGGG - Intronic
1070549096 10:77476462-77476484 ACCGAGCAGCAGAGGGAAGAGGG - Intronic
1070615525 10:77966765-77966787 ACTGAGGCCCAGAGGGATGTGGG + Intergenic
1071028462 10:81143493-81143515 ACTTGGGAGCAGACGAAAGTTGG - Intergenic
1071427963 10:85578578-85578600 AAGGAGAAGCAGAGGGAAGTGGG + Intergenic
1072674259 10:97453862-97453884 CCTGAGCAGCAGGAGGCAGTGGG - Intronic
1074007573 10:109443691-109443713 ATAGAGGAGTAGAAAGAAGTAGG + Intergenic
1074616171 10:115070499-115070521 ACTGAGGCTCAGAAAGAACTTGG - Intergenic
1075049901 10:119175734-119175756 AAAGAGGAGCAGGAGGAAGGGGG + Intronic
1075347466 10:121694203-121694225 ACAGAGGAGAAGAAGGAAAAAGG - Intergenic
1075618987 10:123911905-123911927 ACTGAGGGGCATAAGGCAGAAGG + Intronic
1075762137 10:124864899-124864921 ACTGAGGACCAGATGGCATTTGG - Intergenic
1075982021 10:126748283-126748305 ACTGAGGCCCGGAAGGAAGAAGG + Intergenic
1076088381 10:127656506-127656528 GCTGAGGAGGAGCAGGTAGTGGG - Intergenic
1076190129 10:128477097-128477119 CCTGAGGAGCAGAAGAGAGGTGG - Intergenic
1076390943 10:130101420-130101442 ACTGAGGAGCAGAGAGAGGGTGG + Intergenic
1076812324 10:132893804-132893826 ACTGAGGAGCATAAAGCAGAAGG - Intronic
1078065836 11:8079020-8079042 AGTGAGGTGCAGAAGTAAGATGG - Intronic
1078298487 11:10100673-10100695 ACTGATCAGGAGAAGGAAGGAGG - Intronic
1078632156 11:13012494-13012516 ACTGAGCTGCAGAGGGAAATCGG - Intergenic
1078787486 11:14509221-14509243 ACTGAGGTGAAGAAGATAGTGGG - Intronic
1078819316 11:14861685-14861707 ACTGAGGGGCATAAGGCAGAGGG + Intronic
1078883189 11:15473643-15473665 ACTGAGGACCAGAAATAAGAAGG + Intergenic
1078884325 11:15484935-15484957 AGTGAGGAACACAAAGAAGTAGG + Intergenic
1079276118 11:19039528-19039550 ACTGCAGGCCAGAAGGAAGTAGG + Intergenic
1080357958 11:31473379-31473401 ACTGAGGAGCAGAGAGATGAAGG + Intronic
1081737786 11:45416349-45416371 ACTGAGTTGGAGAAGGATGTAGG - Intergenic
1081781830 11:45718428-45718450 AATGAGGAGTAGAAGGAGGCAGG - Intergenic
1082942726 11:58725608-58725630 ACTGAGGGGCAGAAGGCAGAAGG + Intronic
1085944970 11:81258405-81258427 ATTGAGGAGCAGAAAGGATTGGG + Intergenic
1086203780 11:84234346-84234368 ACTGATGGGCAGAAGGCAGAAGG - Intronic
1087623505 11:100569134-100569156 AGTGAGGAGGAGGAGGAACTGGG - Intergenic
1087650702 11:100863631-100863653 ACTGAAGGACAGAAGGAAATGGG + Intronic
1087961085 11:104349993-104350015 ACTGAGGACCAGAGGTATGTGGG + Intergenic
1087965064 11:104402959-104402981 GCTGATTAGCAGAAGGAGGTGGG - Intergenic
1088110909 11:106260198-106260220 ACCAAAGAGCTGAAGGAAGTAGG - Intergenic
1088491535 11:110393132-110393154 ACTGGGGAGCAGAGGGGAGGTGG - Intergenic
1088840638 11:113624734-113624756 GCTGAGGAGGAGAAGCAGGTAGG - Intergenic
1088928434 11:114325374-114325396 AGTGAGGGGCAGAAGTAGGTGGG - Intergenic
1089400480 11:118161434-118161456 ACTGAGCAGCAGAAGGCACCAGG - Intergenic
1089681039 11:120119159-120119181 CCAGAGGAGAAGAAGGCAGTGGG + Intronic
1090193252 11:124791763-124791785 ACTGGGGAGGAGGAGGATGTGGG + Intronic
1090331904 11:125939217-125939239 GCTGAGGAGCAGGAAGGAGTGGG - Intergenic
1090943449 11:131409235-131409257 TTTGAGAAGCAGAAGGAAGCAGG + Intronic
1091600063 12:1912628-1912650 ACAGAGGAGCAGAAGGAGGGTGG - Intronic
1091714113 12:2764807-2764829 GCTAAAGAGCAGAAGGAAGAAGG + Intergenic
1091878927 12:3960654-3960676 ATTGGGGTGCAGAAGGAAATAGG - Intergenic
1091901242 12:4145731-4145753 GCTGAGGAGCATAAGGCAGCTGG + Intergenic
1092239875 12:6829837-6829859 ACTGAGGAGGCGAAGGGAGGAGG - Exonic
1093203178 12:16214514-16214536 TCTGGGGAGCAGAAGGAGGGTGG + Intronic
1093353873 12:18138721-18138743 ACTGGGGAGCAGAAGGAAGCTGG + Intronic
1093363781 12:18266826-18266848 AATGAGGAGGAGGAGGAAGAAGG - Intronic
1093652069 12:21657535-21657557 GCGGAGGAGCAGAAGGCAGAGGG - Exonic
1093905973 12:24692198-24692220 ACTGAGGAGTATCAGGAAATAGG - Intergenic
1094647791 12:32343641-32343663 ATGGAGGAACAGAAGGAAGGAGG - Intronic
1096103934 12:48985832-48985854 CCTGAGGCCCAGGAGGAAGTGGG + Intergenic
1096131000 12:49158920-49158942 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1096402777 12:51321137-51321159 AGAGAGGATCAGCAGGAAGTGGG + Intronic
1096523758 12:52198694-52198716 ATTGAGCAGCCGGAGGAAGTAGG - Intergenic
1096536099 12:52275799-52275821 ACTGTGGAGCAGACGGCAGAGGG - Exonic
1096544301 12:52327246-52327268 TATGTGTAGCAGAAGGAAGTTGG + Intergenic
1096688180 12:53303012-53303034 CCTGAGGAGCATAGGGAGGTGGG - Exonic
1096820815 12:54232617-54232639 ACTTGGGAGCAGAGGGAAGTTGG + Exonic
1097059866 12:56274838-56274860 ACACAGCTGCAGAAGGAAGTTGG - Exonic
1097134149 12:56837348-56837370 ACTGAGGGGCATAAGGCAGAGGG + Intergenic
1097357129 12:58614394-58614416 AAGGAGGAGGAGAAGAAAGTGGG + Intronic
1097391661 12:59022276-59022298 ACTGAGTAGCACCAGGGAGTGGG - Intergenic
1098306924 12:69111572-69111594 GCTGAGGAGGAGGAGGAAGAGGG - Intergenic
1098524541 12:71471451-71471473 GCTGAGGAGTAGGAGGATGTTGG + Intronic
1098542373 12:71671040-71671062 GCTGAGGAGGAGGAGGAAGAAGG + Intronic
1099188117 12:79537906-79537928 AATGAGACACAGAAGGAAGTGGG + Intergenic
1099652950 12:85451892-85451914 ACTGAAGAGGTGAAGGAGGTAGG - Intergenic
1101407256 12:104439447-104439469 ACTAAGGGGCAGAAGGCAGAAGG - Intergenic
1101408750 12:104452417-104452439 ACTGAGGAGCAGCAAGAGGCAGG + Intergenic
1101672540 12:106889482-106889504 GCTGAAGAGCAGCAGGAACTAGG + Intergenic
1102230355 12:111257588-111257610 AGTGAGGAGGAGAAGGAGGAGGG - Intronic
1103894329 12:124263301-124263323 AGTGAAGAGCTGAAGGAATTAGG - Intronic
1103984033 12:124755268-124755290 ACTGAGGTCCAGATGGACGTGGG - Intergenic
1104487105 12:129161158-129161180 TCTGAGGAACAGCAGGAAGGAGG + Intronic
1108353074 13:49604950-49604972 ACTGAGGGGCATAAGGCAGAGGG - Intergenic
1109204320 13:59465056-59465078 ACTGAGCAACAGCAGGAAGGAGG + Intergenic
1109333848 13:60966966-60966988 ACTGAGGAGCATAAGGCAGAAGG - Intergenic
1109390006 13:61681189-61681211 ACTGGAAAGCAGAAGGAAATGGG + Intergenic
1109646164 13:65260366-65260388 AATGAGGATCAGAATGCAGTCGG - Intergenic
1109781445 13:67115415-67115437 ACCCAGGAGCAGAAGGATGAAGG + Intronic
1110036399 13:70690797-70690819 ACTCAGTAGCAGAAGGAAGAGGG - Intergenic
1110627412 13:77666873-77666895 GAGGAGGAGCAGAAGGAAGTTGG + Intergenic
1111137596 13:84068780-84068802 ACTGAGGAATAGTAGGACGTAGG - Intergenic
1111670072 13:91319526-91319548 GCTGAGGAGGAGGTGGAAGTGGG - Intergenic
1111739438 13:92184462-92184484 CCTCAGGAGAAGTAGGAAGTGGG - Intronic
1111880864 13:93955191-93955213 AGTGAAGTGCAGAAGGAAGTTGG + Intronic
1112284645 13:98093554-98093576 GCAGAGGAGCAGAAAGAAGGAGG - Intergenic
1112941068 13:104862432-104862454 ACTCAGTAGTAGAAGGAGGTGGG + Intergenic
1113103998 13:106752902-106752924 AGTGAGAAGCTGAAGAAAGTGGG + Intergenic
1113258175 13:108530053-108530075 ACTTGGGAGCAGAAGGAATTGGG - Intergenic
1114064686 14:19051174-19051196 ACTGAGTACCAGAGGGATGTAGG - Intergenic
1114097575 14:19348828-19348850 ACTGAGTACCAGAGGGATGTAGG + Intergenic
1114239109 14:20849639-20849661 AATCAGGAGCAGCAAGAAGTGGG - Intergenic
1114376992 14:22157417-22157439 ACTGAAGAACAAAAGCAAGTGGG + Intergenic
1115037420 14:28875380-28875402 ACTTGGGAGAAGAAGGAAGAGGG + Intergenic
1115641887 14:35340393-35340415 TCTGGGAACCAGAAGGAAGTGGG - Intergenic
1115803963 14:37030256-37030278 ACTGAGGAGGAAGAGGAAGAGGG + Intronic
1115936685 14:38560469-38560491 ACTGGGGAACAGGAAGAAGTTGG - Intergenic
1116341259 14:43726157-43726179 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1116708583 14:48335564-48335586 ACTGAGGGGCAGAAGGATAAAGG - Intergenic
1116899450 14:50347839-50347861 ACAGAGGAGCAGAAAGAGGAAGG + Intronic
1116999725 14:51360295-51360317 AATGAGGAGCAGAAGATAGAAGG - Intergenic
1117178364 14:53168355-53168377 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1117197249 14:53353029-53353051 ACTGAGGAGCATAAGGCAGAAGG - Intergenic
1117334100 14:54742116-54742138 ATTGAGGGGGAAAAGGAAGTGGG + Intronic
1117719829 14:58618701-58618723 ACTGAGGAGAAGAAGCCAGAGGG - Intergenic
1118805297 14:69231246-69231268 TCTGAGGAGAAGAAGGAAGAAGG - Intronic
1118915002 14:70095413-70095435 ACTGAGGCACAGAAGGAACCTGG - Intronic
1119129894 14:72162422-72162444 TCTGGGGAGTAGAAAGAAGTAGG + Intronic
1119379523 14:74219604-74219626 AATGAGGAGCAGCAGAAGGTGGG - Intergenic
1119627452 14:76191587-76191609 CCTGGGGAAAAGAAGGAAGTTGG - Intronic
1119888428 14:78164061-78164083 ACTGGGGAGCTGTAGGCAGTGGG - Intergenic
1119960062 14:78845527-78845549 AAGGAGGAGCAGAAGTCAGTGGG - Intronic
1119969082 14:78949216-78949238 GAAGAGGAGCAGAAGGAACTTGG - Intronic
1120111350 14:80561034-80561056 ACTTAGAAGCAGAATGAACTTGG + Intronic
1120969999 14:90199269-90199291 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1121004279 14:90478459-90478481 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1121422390 14:93824779-93824801 CCTGACAAGCAGATGGAAGTGGG - Intergenic
1121612774 14:95292938-95292960 ACGGAGCAGGAGAAAGAAGTGGG + Intronic
1121614589 14:95304759-95304781 TCGGAGCTGCAGAAGGAAGTGGG - Intronic
1121729584 14:96176949-96176971 ACAGAGGAGCAGGAGGAAGAGGG + Intergenic
1202926661 14_KI270724v1_random:31760-31782 CCTGAGGAGCACCAGGAGGTCGG + Intergenic
1123431008 15:20216330-20216352 ACTGAGGGGCAGAAGGCAGAAGG - Intergenic
1123900624 15:24873067-24873089 AATGAGAAGCAGAACAAAGTTGG - Intronic
1124957876 15:34371263-34371285 AAGGAGGAGGAGAAGGAGGTGGG - Intergenic
1125041137 15:35188613-35188635 ACTGAGGGACAGAAGGCAGAAGG - Intergenic
1125423498 15:39527492-39527514 AATGAGGAGCAGGAGAAAGAGGG - Intergenic
1125581218 15:40787408-40787430 ACTGAGGAGCAGAAGGAAGTAGG + Intronic
1127265452 15:57357210-57357232 GCTGAGGAGGAGAAAGAAGAGGG - Intergenic
1127575123 15:60284470-60284492 TCTGAGGAGCATAAGGTAGAAGG + Intergenic
1127879598 15:63145023-63145045 ACAGAGCAGCGGATGGAAGTTGG - Intronic
1128352446 15:66900149-66900171 ACTGAGGATAAGAATGAAGAAGG - Intergenic
1128664837 15:69530544-69530566 GCTGAGACACAGAAGGAAGTGGG + Intergenic
1128846425 15:70901106-70901128 ACTGGGGAACAGGAGGAAGGAGG - Intronic
1129015563 15:72465074-72465096 TGTGTGGAGCAGAAGGAAGAGGG - Intergenic
1129115638 15:73363974-73363996 AGTGACCAGCAGCAGGAAGTCGG + Intronic
1129587408 15:76882596-76882618 ACTGAGGAAGAGTATGAAGTGGG + Intronic
1129834148 15:78691438-78691460 AATGAGGAAATGAAGGAAGTGGG - Intronic
1130160922 15:81399134-81399156 ACTAAGCAGCTGAAGGAATTGGG - Intergenic
1130209419 15:81909612-81909634 ACTGAGGAGCAGAGAGGAGGGGG + Intergenic
1130531531 15:84750495-84750517 GCTAAGGAGAAGAAGGAAGCAGG + Intronic
1130924673 15:88375957-88375979 AATGAGGAAGAGAAGGAAGGAGG - Intergenic
1131302853 15:91214833-91214855 ATTGAGGAGCAGAAAGAACGAGG - Intronic
1131867246 15:96724276-96724298 AGTGAGGAGAAAAAGGAAATGGG + Intergenic
1132078632 15:98845486-98845508 AGGGAGGAGGAGAAGGAAGGAGG - Intronic
1132538653 16:496758-496780 AGAGAGGAGCAGGAGGAAGCAGG - Intronic
1132716100 16:1290553-1290575 GCTGAGGGGCAGAAGGCAGAAGG + Intergenic
1132802720 16:1762231-1762253 CCTGAGGATCTGAAGGAAATTGG + Intronic
1132845980 16:2001093-2001115 AGTGAGGATCAGGAGGAAGGCGG - Exonic
1133190243 16:4128369-4128391 ACAGAGGCACAGAAGGAAGATGG + Intergenic
1133953978 16:10423749-10423771 ACTGATGAGGAGGAGGAAGGAGG - Intronic
1133989058 16:10690821-10690843 GCCCAGGAGCAGAAGGAAGCAGG + Intronic
1134222023 16:12362521-12362543 ACTGAGTTGCAGAAGGATTTTGG + Intronic
1134757529 16:16681410-16681432 ACTGAGGAACACAAGAAACTCGG - Intergenic
1134844144 16:17425643-17425665 AATGAACAGCAGCAGGAAGTTGG - Intronic
1134851764 16:17484579-17484601 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1134988539 16:18677756-18677778 ACTGAGGAACACAAGAAACTCGG + Intergenic
1135042653 16:19129890-19129912 GCTGAGGGGCAGAAGGCAGAAGG - Intronic
1135049528 16:19181313-19181335 TTTGTGGAGCAGAAGGAGGTTGG - Intronic
1135210184 16:20519219-20519241 AATCAGGAGCAGCAGAAAGTGGG - Intergenic
1136565055 16:31064799-31064821 ACTGAGCTGAAGAAGGAAGATGG - Exonic
1136774258 16:32863210-32863232 ATCGGGGAGCAGAAGGAAGAGGG + Intergenic
1136853645 16:33634917-33634939 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1136896353 16:33998304-33998326 ATCGGGGAGCAGAAGGAAGAGGG - Intergenic
1137229749 16:46552882-46552904 GCTGAGGAGAAGGAGGAAGAAGG - Intergenic
1137321559 16:47388521-47388543 AATGAAGACCAGAAGGCAGTGGG + Intronic
1137783929 16:51122049-51122071 ACTGAAGAACAAAAGGAAGCCGG + Intergenic
1137800877 16:51260920-51260942 ACTGAGGGAGAGAAGGAAGAAGG - Intergenic
1138260308 16:55615436-55615458 AAAGAGGAACAGAAGGAAGATGG + Intergenic
1138480385 16:57298920-57298942 ACTGAGGAGCCAAAGAATGTGGG + Intergenic
1138778457 16:59754065-59754087 AGTGAGGTGCTGAAGGAAGGTGG - Intronic
1139343343 16:66286274-66286296 ACTGAGTAGAAGGAGGAAGTGGG + Intergenic
1140128056 16:72134209-72134231 ACTGAGGGGCAGAAGGCAGAAGG - Intronic
1140509038 16:75494386-75494408 CCTGAAGAGCAGAAAGGAGTTGG - Intronic
1141053915 16:80798413-80798435 ACTGAGGAGGAGGAGGAGGAAGG - Intronic
1141676151 16:85518453-85518475 ACCGAGGCGCAGAAGTAACTTGG + Intergenic
1141772990 16:86102117-86102139 ACTGAGGAAGAGAAGGCAGGAGG + Intergenic
1141971801 16:87489606-87489628 ACTGAGGGGCAGAAGGATCCTGG + Intronic
1142311957 16:89319361-89319383 ACTCAGGAGGTGGAGGAAGTGGG + Intronic
1203076682 16_KI270728v1_random:1125329-1125351 ATCGGGGAGCAGAAGGAAGAGGG + Intergenic
1203115236 16_KI270728v1_random:1483362-1483384 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1142835862 17:2586256-2586278 ACTGAGGAGCAGCAGGAACGGGG - Intergenic
1143542596 17:7578533-7578555 GCTGAGGAGCAGCAGGAGGGGGG + Exonic
1144077804 17:11734597-11734619 CCGGTGGGGCAGAAGGAAGTGGG + Intronic
1144365433 17:14540173-14540195 ACCGAGGAGCACAAGGCAGAAGG + Intergenic
1144523053 17:15967102-15967124 ACAGAGGCCCAGCAGGAAGTGGG + Intronic
1144600580 17:16609064-16609086 CCTGATGATTAGAAGGAAGTAGG - Intergenic
1145735991 17:27232028-27232050 ACTGTAGGGCAGAAGGAAATGGG + Intergenic
1145901447 17:28493111-28493133 AGTCAGCAGCAGAAGGAAGTGGG + Intronic
1146052166 17:29562810-29562832 ACTGAGCAGGAGGAAGAAGTAGG + Exonic
1146144495 17:30401271-30401293 AAAGAGGAGGAGAAGGAAGAAGG - Intronic
1146512359 17:33461118-33461140 GCTGAGGAGCAGGTGGAAGTGGG - Intronic
1146535821 17:33650827-33650849 ACTGAGGAGTGGAAGGAAAGGGG + Intronic
1146662417 17:34673641-34673663 AAAGAGCAGGAGAAGGAAGTAGG - Intergenic
1147036955 17:37688821-37688843 ACTGAGGAGCAGCAGGGGCTTGG - Intronic
1147056401 17:37838602-37838624 AATGTGGATCAGAAGGAAGCGGG - Intergenic
1147412573 17:40264410-40264432 ACTAAGGAGCCGAGTGAAGTAGG + Intronic
1147424250 17:40338290-40338312 ACAGAGGAGGAGGAGGAAGAAGG - Intronic
1147791205 17:43015284-43015306 ACAGGGGAGGAGAAGGAGGTGGG + Exonic
1148805449 17:50261537-50261559 ACTGATGGGCAGAAGGATGGGGG + Intergenic
1148869416 17:50647446-50647468 TCTGAGAGGCAGCAGGAAGTAGG + Intronic
1149082114 17:52670120-52670142 ACTGAGGAGTAAAAGGAGATAGG + Intergenic
1149107691 17:52989192-52989214 AGTAAGGGGAAGAAGGAAGTTGG + Intergenic
1149531513 17:57399326-57399348 TCTAATGGGCAGAAGGAAGTAGG + Intronic
1149888138 17:60361196-60361218 ACTGAGGGGAGGAAGTAAGTAGG - Intronic
1150161373 17:62901017-62901039 TCTGAGGTGCAGCAGGAAGCAGG - Intergenic
1150206840 17:63415441-63415463 GCTGAGAAGAAGAAGGGAGTGGG + Intronic
1150827892 17:68492734-68492756 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1151304133 17:73252087-73252109 CCTGGGGAGCAGAAAGGAGTGGG + Intronic
1151439867 17:74121345-74121367 ACATACAAGCAGAAGGAAGTAGG - Intergenic
1151821716 17:76500540-76500562 TCTGAGGAGCAGAAGGCGGTGGG - Intronic
1152984609 18:310521-310543 ACTGAAGGTCAGAAGGATGTGGG - Intergenic
1153333770 18:3901082-3901104 AGGGAGCAGCAGAAGGGAGTAGG - Intronic
1153416037 18:4846651-4846673 GCTGAGTTGCAGAAGGAAGCAGG - Intergenic
1153629373 18:7054741-7054763 GCTGAGGAGGAGGAGGAAGAGGG - Intronic
1155358203 18:24974128-24974150 TCTGAGGATCAGCTGGAAGTTGG - Intergenic
1155423797 18:25684864-25684886 GGTGAGGAGCAGAAGGCAGAAGG - Intergenic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1156083868 18:33375883-33375905 ACTGAGAAGCATAAGGCAGAAGG + Intronic
1156149946 18:34228933-34228955 AGGGAGGAGCAGAAGCAAGTTGG + Intergenic
1156525287 18:37761585-37761607 GTTGAGAAGCAGCAGGAAGTGGG + Intergenic
1157401028 18:47387761-47387783 ACTGAGGAAAAGCAGAAAGTTGG - Intergenic
1158436637 18:57438968-57438990 ACCGGGGACCAGAAGGAACTTGG + Intronic
1159056500 18:63470925-63470947 ACAGAGGAGGAGAAGGGAGGAGG + Intergenic
1159539947 18:69761935-69761957 ACTGAGGGGCATAAGGCAGAAGG + Intronic
1160480306 18:79233991-79234013 GCTGAGGAGGAGGAGGAAGGAGG + Intronic
1160822562 19:1065312-1065334 ACCGAAGAGCAGAAGGAGGCAGG + Exonic
1160950837 19:1666518-1666540 AATAAGGAGAAGAAGGAAGAAGG - Intergenic
1161085419 19:2332902-2332924 GCAGGGGAGCAGAAGGAAGGTGG + Intronic
1161931740 19:7345192-7345214 TTTGAGGAACAGAAGGAAGCAGG - Intergenic
1162224437 19:9208363-9208385 ACTGAGGAACAAAAGTATGTTGG + Intergenic
1162676942 19:12306271-12306293 ACTTAGGAGGAGAATGAATTGGG - Intergenic
1162939252 19:13998113-13998135 ACTGAGGCCCAGAAGAAGGTTGG - Intronic
1163013326 19:14439122-14439144 ACTGAGAGGAAGCAGGAAGTTGG + Intronic
1163345198 19:16736818-16736840 ACTGATCAGCAGAGGGAAGTAGG + Intronic
1163562970 19:18031565-18031587 ACACAGCTGCAGAAGGAAGTTGG + Intergenic
1163620896 19:18359397-18359419 TTTGAGGAGCAGGAGGAAGCTGG - Intronic
1164180076 19:22810604-22810626 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1165087925 19:33364275-33364297 ACTGAGGTGCAGAAGAAACTGGG - Intergenic
1165150372 19:33756749-33756771 AGTGAGGCCCAAAAGGAAGTGGG - Intronic
1165259506 19:34599753-34599775 ACTGAGGAACAGGGGGAAGAGGG - Intronic
1166504213 19:43361423-43361445 GCTGGGGAGCAGAGGGAAGGTGG - Exonic
1166506246 19:43373335-43373357 GCTGGGGAGCAGAGGGAAGGTGG + Intergenic
1166751356 19:45165284-45165306 ACTGACGAGCACCAGCAAGTTGG - Intronic
1166863111 19:45821051-45821073 CCCGAGGAACAGAAGGAAGCAGG - Intronic
1167222973 19:48215150-48215172 ACTGAGGGGCATAAGGCAGAAGG - Intronic
1167634322 19:50645280-50645302 ATTGAGTGGCAGAGGGAAGTCGG + Intronic
1168472300 19:56649592-56649614 AGTGAGGACCTGAAGGAGGTGGG + Intronic
925083293 2:1087056-1087078 GCTAAGGAGCAGAAGGAGGGTGG + Intronic
925436901 2:3846251-3846273 AAGGAGGAGAAGAAGGGAGTGGG - Intronic
925751619 2:7094858-7094880 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
925773167 2:7304395-7304417 TCTGACCAGCAGCAGGAAGTTGG + Intergenic
926377077 2:12241554-12241576 TCTGAGGAGGAGGAGGAAGAGGG + Intergenic
926439572 2:12874118-12874140 ACTGAGGGGCATAAGGCAGAGGG + Intergenic
926861773 2:17317493-17317515 AAGGAGGAGGAGAAGGAAGTGGG + Intergenic
927190055 2:20511355-20511377 ACTGAGGAGCAGAAGGGAACCGG - Intergenic
927551924 2:24008972-24008994 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
928233435 2:29520001-29520023 ACTAAGGAGAAGGAGGAATTGGG + Intronic
928331949 2:30364536-30364558 AGAGAGGAGCAGGAGGAAATGGG + Intergenic
928343299 2:30465246-30465268 ACAGAGGAGGAGGAGGCAGTTGG + Intronic
928854940 2:35791676-35791698 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
929009196 2:37424341-37424363 ACTGAGCAGCATAAGGCAGAAGG + Intergenic
929508772 2:42550496-42550518 ATGGAGCAGCAGAAGGAAGGAGG + Intronic
929876942 2:45804518-45804540 ACTGAGGTGCTGAAGTATGTGGG + Intronic
930591049 2:53326750-53326772 ACTGAGGGGCACAAGGCAGAAGG - Intergenic
930686333 2:54312472-54312494 ACTGAGGTACAGATGGAGGTAGG - Intergenic
931315736 2:61128965-61128987 ACGAAGGAGGAGAAGGCAGTGGG + Intronic
931859004 2:66334137-66334159 AGTGAGGATCAGAAAGAAGCGGG - Intergenic
931942968 2:67273285-67273307 AGGGAGGTGGAGAAGGAAGTGGG - Intergenic
932279163 2:70474623-70474645 ATTGAGGAGCTGCTGGAAGTAGG + Intronic
932336975 2:70937231-70937253 ACAGAGGAACAGAGGGAGGTGGG - Intronic
934613353 2:95756446-95756468 ACTGAGGAGCAGAGGGGATGGGG - Intergenic
934647544 2:96067974-96067996 ACTGAGGAGCAGAGGGGATGGGG + Intergenic
934840918 2:97623794-97623816 ACTGAGGAGCAGAGGGGATGGGG + Intergenic
935325150 2:101929060-101929082 ACTGAGGGGAAGAAGTAAGAAGG + Intergenic
935425485 2:102914323-102914345 ACTGAGGAACATAATGAAGCTGG - Intergenic
936324098 2:111490155-111490177 ACAGAAGAGAGGAAGGAAGTGGG - Intergenic
936345962 2:111675281-111675303 ATTGAGGAGCAGAAAGTTGTTGG + Intergenic
936496544 2:113027207-113027229 ACTGAGGAGAAGAAAGAGGAGGG + Intronic
936910610 2:117588696-117588718 ATTGAGGAGAAGAATGAAATAGG - Intergenic
936919560 2:117673896-117673918 GCTGTGGGGCAGAAGGAAATAGG + Intergenic
936992611 2:118382205-118382227 GCTGAGGAGGAGGAGGAAGAGGG - Intergenic
937254731 2:120547146-120547168 ACTGAGGCCCAGAAGGAATCAGG + Intergenic
937340181 2:121086248-121086270 GGTGAGGGGCAGAAGGAAGGGGG + Intergenic
937937292 2:127256447-127256469 ACTGAGGAGAAGAAAGTATTAGG - Intergenic
937941021 2:127286149-127286171 GCTGAGCAGCAAAAGGAAGATGG + Intronic
938249998 2:129807185-129807207 GCTGAAAATCAGAAGGAAGTGGG - Intergenic
938481966 2:131670206-131670228 ACTGAGTACCAGAGGGATGTAGG - Intergenic
938813852 2:134879393-134879415 ACTGATTAGTAGGAGGAAGTAGG - Intronic
938875945 2:135531604-135531626 ACTGAGGAGGAGGAGGCGGTTGG - Intronic
939795900 2:146643625-146643647 CCTTAGAAGCAGAAGAAAGTGGG + Intergenic
939858474 2:147389558-147389580 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
940523176 2:154777837-154777859 ACTGAGGAGAAAAAGGAGATTGG + Intronic
940868438 2:158839468-158839490 ACTGAGGGGCATAAGGTAGAGGG - Intronic
941996000 2:171602541-171602563 TCTGAGGATGAGAAGGAAGTAGG - Intergenic
942588622 2:177515468-177515490 ACTTGGGGGCAGAAGGAAGAAGG - Intronic
942901220 2:181121585-181121607 TCAGAGGACCAGAAGGAAGCTGG + Intergenic
943387478 2:187220461-187220483 ACTGAGGAGTTGACAGAAGTAGG + Intergenic
943398814 2:187377970-187377992 AATTAGTAGAAGAAGGAAGTTGG + Intronic
943903020 2:193465449-193465471 ACTGAGGGGCATAAGGCAGAGGG + Intergenic
944240099 2:197478004-197478026 ACTGAGAGGCAGAAGAAAGGTGG + Intergenic
944329832 2:198452671-198452693 TCTGAGGAGCAGCAGGAATATGG + Intronic
944364522 2:198901990-198902012 ACTGAGGACAAGAAGAAAATGGG - Intergenic
944586168 2:201175750-201175772 ACTGAGGGGCATAAGGCAGAAGG + Exonic
944922439 2:204429413-204429435 ACTGAAGAGCTGTAGTAAGTGGG + Intergenic
945197168 2:207247707-207247729 TATGAGGAGCAGCGGGAAGTAGG + Intergenic
945319199 2:208402070-208402092 AGTGAGGAGTAGCAGGAACTGGG - Intronic
945347241 2:208732542-208732564 GCTGAAGAGAAGGAGGAAGTGGG + Intronic
946053884 2:216884839-216884861 ACTGAGGGGCATAAGGCAGAGGG + Intergenic
946200610 2:218068824-218068846 ACTGAGGTGGAGAAGGAAGGAGG + Intronic
946310143 2:218878778-218878800 ACTGAGGCCCAGAAAGAATTAGG - Intergenic
946693393 2:222327434-222327456 GCTGAGGAGGAGGAGGAAGAGGG - Intergenic
946940020 2:224760715-224760737 ACTGAGGAGAAGAGGGAGATGGG + Intergenic
947156887 2:227171729-227171751 ACTGAGGGGCAGAAGGCTGAAGG + Intronic
947463060 2:230319848-230319870 ACTGGGGAGCATGAGGAAGTGGG - Intergenic
947941896 2:234064129-234064151 AATGAGGGGGAGAAGGAAGAGGG - Intronic
948360017 2:237413258-237413280 TCAGAGGAGAAGAAGGAATTGGG - Intronic
948426730 2:237892780-237892802 ATTGAGGAGAAGGAAGAAGTGGG - Intronic
1170202954 20:13764764-13764786 GCTGAGGAGGAGCAGGAAGAGGG + Intronic
1171935136 20:31268020-31268042 ACTGATGAGCTGATAGAAGTAGG - Intergenic
1172197408 20:33101401-33101423 ACTGAGGCTCAGAGTGAAGTTGG - Intronic
1172386976 20:34540876-34540898 ACTGAAGGTCAGAAGGAAGCTGG - Exonic
1173137311 20:40450182-40450204 CCTGAGGAGCTGAAGAAACTTGG - Intergenic
1173924974 20:46773963-46773985 ACCGAGGCGCAGAAGGCAGAAGG - Intergenic
1174194320 20:48762241-48762263 ACTGAGGAGCCCAAAGGAGTAGG - Intronic
1174280526 20:49435688-49435710 GCTGAGGAGCAGATGAAAGGAGG + Intronic
1174733841 20:52945083-52945105 GCTGAGGAGGAGAAGGAAGAGGG + Intergenic
1175264991 20:57697122-57697144 AAGGAGGAGCAGATGGGAGTTGG + Intronic
1175631005 20:60536385-60536407 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1176107819 20:63397867-63397889 ACGGAGGAGCAGAGGGCAGCTGG - Intergenic
1177547662 21:22579465-22579487 ACTGAGGGGCATAAGGAAGAAGG - Intergenic
1177608808 21:23419121-23419143 TCTGAGGAGCAGCAAAAAGTTGG - Intergenic
1178123086 21:29489249-29489271 AATGAGGGGCAGAAGGCAGAAGG - Intronic
1178816406 21:35933966-35933988 ACTTAGAAGGAGAAGGAAGGAGG + Intronic
1179254821 21:39706504-39706526 ACTGAGGGGCATAAGGCAGAGGG + Intergenic
1179634131 21:42696586-42696608 ACTGAGAAGAGGAAGGAAGGAGG + Intronic
1180105604 21:45616408-45616430 CCTGAGGGGCAGAAGGGACTGGG - Intergenic
1180419178 22:12798397-12798419 AGTGAGGACCAGAAGCAACTGGG - Intergenic
1180483174 22:15773796-15773818 ACTGAGTACCAGAGGGATGTAGG - Intergenic
1180743680 22:18072158-18072180 ACTGAAGAGCACAAGGGAGGTGG + Intergenic
1180971960 22:19820496-19820518 ACTGAGGGGCAGAATGGGGTGGG - Intronic
1181102382 22:20550119-20550141 ACTCAGGAACAGAAGCAAGGTGG - Intronic
1181263007 22:21612188-21612210 ACTGAGTAGAAGAAAGGAGTGGG + Intronic
1181500589 22:23313590-23313612 AGTGAGGAACACAAGGAGGTGGG - Intronic
1182240877 22:28915063-28915085 ACCAAGGAGCAGAAGAAATTTGG - Intronic
1184965250 22:47966661-47966683 GCTGTGGAGGAGAAGGAAGGCGG - Intergenic
949280973 3:2346472-2346494 ACTTTTGAGCAAAAGGAAGTGGG - Intronic
949676454 3:6459844-6459866 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
952108055 3:30092056-30092078 ACTGGGAAGCAAAAGGAACTAGG - Intergenic
952210186 3:31222472-31222494 ACTGTGGTGCAGAAGGAGGGAGG - Intergenic
952957168 3:38564635-38564657 AAGGCTGAGCAGAAGGAAGTGGG - Intronic
953173567 3:40529266-40529288 AGTGAGAAGTAGAAGGAAGAAGG - Intronic
953798938 3:46006627-46006649 ACTGAGGGGCATAAGGCAGAGGG - Intergenic
954449256 3:50562910-50562932 CCTGAGGAGAGGGAGGAAGTGGG + Intronic
954653364 3:52178692-52178714 CCTGAGGAGCAGCAGGCAGAAGG + Intergenic
954759945 3:52866743-52866765 ACTGACTAGCAGAAGGAAGTTGG + Intronic
955150639 3:56363506-56363528 AGTGAGAAGCAGAAGCAAATAGG + Intronic
956012653 3:64848170-64848192 AATGACTAGCACAAGGAAGTGGG - Intergenic
956104304 3:65801010-65801032 ACAGAGGAGAAGAACTAAGTAGG - Intronic
956494994 3:69815402-69815424 GCTGAGGGGGAGAAGGAAGAGGG - Intronic
957222598 3:77402951-77402973 ACTGAGGGGCATAAGGCAGAAGG - Intronic
958683265 3:97357924-97357946 GCTGAGGAGAAGAAAGAAGAGGG + Intronic
958781110 3:98543440-98543462 ACTGAAGAGCAGAAGGTGGAAGG - Intronic
958856318 3:99390509-99390531 TCTGAAGACCAGAAGGAAGCAGG - Intergenic
959333353 3:105034705-105034727 ACTGAGCAGCATAAGGCAGAAGG + Intergenic
959420339 3:106120522-106120544 ACGGAGGAGCTGCAGGAAATGGG + Intergenic
959693624 3:109225691-109225713 AATGATAAGCAGAAGGAAGATGG + Intergenic
959889383 3:111537069-111537091 ACTGGGGAGGAGAAGTAAGTAGG - Intronic
960365210 3:116762700-116762722 ACTGAGGAGCAGACAGAAAGAGG + Intronic
960576658 3:119236880-119236902 GCAGAGGAGCGGAAGGCAGTGGG - Exonic
960709411 3:120512270-120512292 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
961346034 3:126263943-126263965 ATTGGGGAGCAGAAGGGAGGAGG + Intergenic
961496912 3:127299958-127299980 CCTGAGGTGCAGAAGGCTGTTGG - Intergenic
961904175 3:130245382-130245404 ACTGAGAACCAGAAGGTGGTAGG + Intergenic
961984094 3:131114016-131114038 AGTGAGGAGGGGGAGGAAGTTGG + Intronic
962846221 3:139275992-139276014 ACTAAGGAGTAGAGGTAAGTTGG + Intronic
962966877 3:140363885-140363907 AATGAGGAGCAGTAGGAGGCAGG + Intronic
964249792 3:154699735-154699757 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
964252476 3:154734638-154734660 TCTGAGGAATAGAAAGAAGTGGG + Intergenic
964441719 3:156718172-156718194 GCTGAGGAGGAGGAGGAAGGGGG + Intergenic
964737596 3:159932590-159932612 ACTTTGGAGGAGAAGGAACTAGG - Intergenic
965462566 3:168985626-168985648 ACTGAGGAGGAAAGGGGAGTGGG + Intergenic
967462027 3:189758660-189758682 ACTGAGGGGCATAAGGCAGAGGG - Intronic
967488133 3:190057883-190057905 ACTGAGGAAGAGAGGGAAGAAGG - Intronic
968332701 3:197885176-197885198 TCTGAGGAGCAGCAGGAGGGCGG - Intronic
968907657 4:3462142-3462164 ACTGAGGAGCAAATGGAATCAGG - Intergenic
968951911 4:3699817-3699839 ACTGAGGGGCAGAGGCAAGAGGG + Intergenic
969167593 4:5330117-5330139 ACTGAGGCCCAGAGGGAAGAAGG - Intronic
969520009 4:7671659-7671681 GCTGAGGAGCAGAAAGAATAAGG + Intronic
969643184 4:8411412-8411434 ACTGAGGAGAAGTAGGAGGTGGG + Intronic
970471104 4:16380055-16380077 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
971092748 4:23363680-23363702 ACTGAGGAGCTAAAGGAGGTGGG - Intergenic
971504479 4:27351267-27351289 ACTGATGACCACAAGGAAGCAGG + Intergenic
972241874 4:37202229-37202251 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
974147291 4:57964576-57964598 GCTGAGGAGGAGGAGGAAGAGGG + Intergenic
974170841 4:58265155-58265177 ACTGAGGAGCATAAGACAGAAGG - Intergenic
974724632 4:65782844-65782866 GCTGATGAGCAAAAGGAATTGGG + Intergenic
975459798 4:74637674-74637696 GCTGAGGAATAGAAAGAAGTTGG + Intergenic
975726266 4:77294665-77294687 ACTGATCAGCAGGAGGAAGCTGG - Intronic
976004965 4:80419086-80419108 ACTGAGGACCATAAGGCAGAAGG + Intronic
976008547 4:80459558-80459580 ACTGAGGGGCATAAGGCAGAAGG - Intronic
976786102 4:88823339-88823361 ATTGAGGAGCAGAAGGAGTAGGG - Intronic
977140860 4:93370052-93370074 AGTGAGGATTAGAAGGAAGGGGG - Intronic
977613457 4:99061002-99061024 ACTGAAGACCAAAATGAAGTTGG + Intronic
977701477 4:100027931-100027953 AATGAGTAGCAGAAGAAGGTAGG - Intergenic
978153723 4:105466556-105466578 ACTGAGGGGCAGAAGGCAGAAGG + Intronic
978210631 4:106131705-106131727 ACTGAGTAACAGACAGAAGTTGG + Intronic
978308995 4:107364711-107364733 ACTGGGTAACAGGAGGAAGTTGG + Intergenic
978400725 4:108327707-108327729 AAGGAGAAGAAGAAGGAAGTAGG - Intergenic
978668918 4:111222617-111222639 ACTGAGGTGCATAAGGCAGAAGG + Intergenic
980875986 4:138662624-138662646 ACTGAGAAGCAAAAGGCAGTTGG - Intergenic
981048909 4:140292045-140292067 ACAGAGGAGCAGGAGGCAGAGGG - Intronic
981659538 4:147149237-147149259 GCAGAGGGGCAGAGGGAAGTTGG - Intergenic
981955570 4:150469052-150469074 AATCAGAAGGAGAAGGAAGTGGG - Intronic
982465191 4:155721882-155721904 TGTGAGGAGTAGAGGGAAGTTGG + Intronic
983406310 4:167335475-167335497 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
984084480 4:175291993-175292015 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
984167364 4:176319462-176319484 TCTGAGGAGCAGTGGGGAGTGGG - Intergenic
984881380 4:184412704-184412726 AGCAAGGAGCAGAAGGAAGGTGG - Intronic
985146577 4:186900170-186900192 ACTCTGTAGCAGAAAGAAGTGGG + Intergenic
985303825 4:188517490-188517512 GGTGAGGAGTAGAAGGATGTTGG + Intergenic
1202762586 4_GL000008v2_random:125159-125181 ACTGAGGGTCAGAAAGAAGCCGG + Intergenic
985587126 5:746265-746287 AGTGAGGAGCAGATGGCGGTGGG + Intronic
985601697 5:838448-838470 AGTGAGGAGCAGATGGCGGTGGG + Intronic
985779680 5:1863737-1863759 ACTGAGAGGCAGAAGGCAGAAGG + Intergenic
985924753 5:3007105-3007127 TCTGAGCAGCAGAAGACAGTTGG + Intergenic
985950680 5:3219508-3219530 CCTGATGAGCAGGAGGAGGTGGG + Intergenic
986066614 5:4240611-4240633 ACGGAGGGGCAGAAGGCAGAAGG - Intergenic
986957093 5:13165818-13165840 GCTGAGGAAGAGGAGGAAGTGGG + Intergenic
986977804 5:13412573-13412595 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
987005297 5:13704089-13704111 GGTGAGGGGCATAAGGAAGTAGG + Intronic
987557847 5:19478557-19478579 AATGAGGATCAGAATGGAGTTGG - Intronic
987655011 5:20796196-20796218 ACTGAGGAGCATAAGGCAAAAGG - Intergenic
988211990 5:28215862-28215884 AAGGAGGAGAAGAAGGAGGTGGG - Intergenic
988629672 5:32915304-32915326 GCTGAGGGGCAGAAGGTAGATGG - Intergenic
988768552 5:34407706-34407728 ACTGAGGAGCATAAGGCAAAAGG + Intergenic
989144376 5:38234307-38234329 ACTGAGTAACAGACAGAAGTTGG + Intergenic
989420146 5:41228492-41228514 ACTGAATAGAAGAAGAAAGTGGG + Intronic
990018583 5:51097970-51097992 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
990114281 5:52369291-52369313 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
990318055 5:54602571-54602593 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
990430116 5:55726269-55726291 ACTTAGGAGCCGAAGGCAGGAGG - Intronic
990915346 5:60897012-60897034 GATGAGGAACAGAAGGAACTAGG - Intronic
991048237 5:62245262-62245284 ACTGATGGGCAGAAGGCAGAAGG - Intergenic
991220702 5:64212257-64212279 AGTGAGGAGCAGTAAGAGGTTGG - Intronic
992315268 5:75546353-75546375 ACTAAGGAGGAGAAAGCAGTGGG + Intronic
992399121 5:76395538-76395560 ACTGAGGGGCATAAGGCAGAGGG - Intergenic
992565233 5:77989553-77989575 ACTGAGGAAAGGAAGGAAGTTGG - Intergenic
992714108 5:79492580-79492602 ACTGAGCAGTAGCAGGAAATGGG + Intronic
993138115 5:83996370-83996392 ACTGAGCAGCAGAAGGAACAAGG + Intronic
993364864 5:87022822-87022844 ACTGAGCAGCATAAGGCAGAAGG - Intergenic
993724410 5:91351846-91351868 ACTAAGGAGCATAAGGCAGAAGG - Intergenic
993835301 5:92812476-92812498 AAAGAGGAGCAAAAGGAAGAAGG + Intergenic
994489121 5:100419330-100419352 ACTGGGGCACAGAAGGAGGTGGG + Intergenic
994754016 5:103772825-103772847 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
995191399 5:109322443-109322465 ACTGAGGGGCATAAGGTAGAAGG - Intergenic
995425333 5:112015055-112015077 TCTGGAGAGCAGAAGGAGGTTGG + Intergenic
995457916 5:112371472-112371494 TCTGAGGAACGGAGGGAAGTGGG - Intronic
995482897 5:112610398-112610420 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
995834961 5:116391037-116391059 GCTGAGGAGGGGGAGGAAGTGGG - Intronic
996221853 5:120942511-120942533 TCAGAAGGGCAGAAGGAAGTTGG + Intergenic
996998131 5:129724481-129724503 ACTGAGAAGCATAAGGCAGAAGG + Intronic
997071177 5:130623951-130623973 AGTGAGTAAGAGAAGGAAGTAGG - Intergenic
997670376 5:135666485-135666507 ATCGAGGAGCAGAAGGATGTAGG - Intergenic
997989975 5:138536527-138536549 AGTGAGGGGGAGAAGGAATTAGG - Intronic
998290731 5:140911593-140911615 ACTAAGGAACATAATGAAGTTGG - Intronic
998781707 5:145664365-145664387 ACTAAGAAGCAGAATGAAGAAGG + Intronic
998796095 5:145820710-145820732 ACTGAGGGGCATAAGGCAGAAGG + Intronic
998855175 5:146387733-146387755 TTTGAGGAGAAGAAGGAAGGAGG - Intergenic
999064987 5:148676006-148676028 TGTGAGAAGCAGAAGGAAATCGG - Intronic
999125001 5:149240089-149240111 ACTGAGAAGCAGCAGGAAGGTGG + Intronic
999446849 5:151646911-151646933 TCTGAGGGACAGATGGAAGTAGG + Intergenic
999682951 5:154076769-154076791 ACTGGGGAGAAGATGGCAGTGGG - Intronic
999762828 5:154715761-154715783 ACTAGGGAGCAGAAGGGATTGGG + Intronic
999889373 5:155960145-155960167 AATGAAGAGGAGAAGGAAGATGG - Intronic
1000118174 5:158172838-158172860 ACGGATGAGTAGAAGGGAGTTGG + Intergenic
1000142482 5:158418998-158419020 ACTGAGTAGCAGAAGGAAGAGGG + Intergenic
1000222831 5:159230588-159230610 ACAGAGGAATTGAAGGAAGTTGG + Intergenic
1000838673 5:166188486-166188508 ACTGAGGGGCAGCAGGAGGGAGG + Intergenic
1001080466 5:168663630-168663652 ACTGAGGAGCAGAGAGAAATGGG - Intronic
1001197161 5:169684174-169684196 ACTGAAAGGCAGAAGGAAGAAGG - Exonic
1001210913 5:169809474-169809496 AGAGCGGAGGAGAAGGAAGTGGG - Intronic
1001289502 5:170446751-170446773 ACTGGGGAGAAGATAGAAGTGGG - Intronic
1001313641 5:170628022-170628044 AAGCAGGAGCAGAAGGAAGAGGG - Intronic
1001975921 5:175998200-175998222 ACTGAGGAGGCCAAGGCAGTGGG + Intronic
1002241505 5:177845572-177845594 ACTGAGGAGGCCAAGGCAGTGGG - Intergenic
1002852452 6:1008423-1008445 ACTGAGGAGGAGAGGGAACTGGG + Intergenic
1003865840 6:10361780-10361802 ACTGAGGAGGCTAAGGAAGAAGG - Intergenic
1005084169 6:21987027-21987049 ACTGAGGTGCAGCAAAAAGTGGG - Intergenic
1005569661 6:27132671-27132693 ACTAAGGCGCAGAAGAAAGACGG - Exonic
1005643955 6:27824020-27824042 ACTGAGAACCTGAAAGAAGTCGG - Intergenic
1005645241 6:27831610-27831632 ACTGAGAACCTGAAAGAAGTCGG + Intergenic
1006056398 6:31387972-31387994 ACTGAGGAGGAGCAGCCAGTTGG - Intergenic
1006174997 6:32116346-32116368 GGTGAGAAGCAGCAGGAAGTAGG - Intronic
1006338261 6:33432044-33432066 GCTGAGGGGCAGAGGGAGGTGGG + Intronic
1006798845 6:36746819-36746841 GCACAGGGGCAGAAGGAAGTGGG - Intronic
1006826422 6:36939294-36939316 GCAGAGGACCAGAAGGAGGTTGG + Intergenic
1007458222 6:41997380-41997402 ACTAAGGTGCAGTAGGAAGCAGG + Intronic
1007839630 6:44705086-44705108 ACTGAGAGGCAGATGGAAGGTGG - Intergenic
1007965776 6:46002540-46002562 GAAGAGGACCAGAAGGAAGTGGG - Intronic
1008054564 6:46933012-46933034 ACTGAGGAGAAGCACAAAGTTGG + Intronic
1009056785 6:58345908-58345930 ACTGAGGAGGAGAAAGAGGAGGG - Intergenic
1009401552 6:63262302-63262324 ACTGAGGAGCATAAGGCAGAAGG + Intergenic
1009572806 6:65410540-65410562 ACTGGGGAGGGGAAGGAAGAGGG - Intronic
1009859143 6:69303420-69303442 GCTGAGGAGGAGAAAGAAGAGGG - Intronic
1009862120 6:69347674-69347696 ATTCAGGAGGAGAAGGTAGTAGG + Intronic
1010318583 6:74479871-74479893 ACTGCGTAACAGAGGGAAGTGGG + Intergenic
1010977293 6:82330040-82330062 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1011103434 6:83750720-83750742 AATCAGCAGAAGAAGGAAGTGGG + Intergenic
1011650277 6:89499789-89499811 ACTGAGGAGCAGCAGGGAAAGGG - Intronic
1011712823 6:90071946-90071968 ACTGAGGAGGAGGAAGAAGAGGG + Intronic
1014528047 6:122524115-122524137 AAGGAGGAGGAGAAGGAAGAAGG - Intronic
1014762709 6:125375204-125375226 ACAGAGGAAAAGAAGGAAGGAGG - Intergenic
1015203538 6:130609401-130609423 ACTGAGGAGTAAAAGTAGGTGGG + Intergenic
1015861916 6:137690322-137690344 CCTAAAGAGCAGAAGGGAGTGGG + Intergenic
1016166262 6:140948248-140948270 GGTAAGGAGAAGAAGGAAGTGGG - Intergenic
1016269498 6:142272389-142272411 ACTGGGGAGCAGAAAGAAAAGGG + Intergenic
1017213128 6:151879161-151879183 CCTGAGAGGCAGAAGGAACTGGG + Intronic
1017694433 6:157000308-157000330 ACTGTGAACCAGAGGGAAGTAGG + Intronic
1018107718 6:160504803-160504825 ACCAAGGAGCATAATGAAGTTGG - Intergenic
1018599917 6:165527792-165527814 ACTGAGGAAGAGAAGGCAGATGG - Intronic
1019406071 7:884721-884743 ACTGAGGACCAGAATGACCTTGG - Intronic
1019817732 7:3213422-3213444 ACTGAGGGGCATAAGGTAGAAGG - Intergenic
1020567747 7:9818747-9818769 ACTAAGGAACATAATGAAGTTGG - Intergenic
1020956754 7:14748532-14748554 AGTGAGGAGGAGCAGGAAATTGG + Intronic
1021416804 7:20395817-20395839 ACTAATAAGCAGAAGAAAGTGGG + Intronic
1021891175 7:25187715-25187737 ACAGAGAAGCAGAGGGAAATTGG - Intergenic
1022250827 7:28606538-28606560 ACTGAGAGGCAGAGGGAAGATGG - Intronic
1022675391 7:32495118-32495140 ACAGAAGAGAAGAGGGAAGTGGG + Intronic
1022736792 7:33083734-33083756 AAAGAGGAGCAGAAGTAAATGGG - Intergenic
1022882082 7:34598631-34598653 ACTTTGGAGCAGAAAGAAATTGG + Intergenic
1023071740 7:36441573-36441595 ACTGAGGAGCAGCAAGAGGCAGG + Intronic
1023144155 7:37132625-37132647 TGGGTGGAGCAGAAGGAAGTGGG - Intronic
1023163196 7:37318019-37318041 ACTGAGGAGCAGAAAGATGGTGG + Intronic
1023615130 7:42012016-42012038 GGTGAGGACCAGCAGGAAGTCGG - Intronic
1023684309 7:42719056-42719078 TCTGAGGAGCATAAGGCAGAAGG + Intergenic
1024097604 7:45996403-45996425 CATGAAGGGCAGAAGGAAGTGGG + Intergenic
1024296522 7:47847437-47847459 ACTGGCGAGGAGCAGGAAGTGGG - Intronic
1025228135 7:57181183-57181205 AATGAGGAGGAGGAGGAAGAGGG - Intergenic
1026104170 7:67407903-67407925 ACACAGAAGGAGAAGGAAGTGGG - Intergenic
1026401826 7:70021679-70021701 ATTGAGGAGCAGCAGGAAGGAGG - Intronic
1027275967 7:76556408-76556430 CCTGAGGAGGGGAAGGAAGATGG - Intergenic
1027616557 7:80431302-80431324 ACTGAGGGGCATAAGGTAGAAGG - Intronic
1028311908 7:89349161-89349183 ACAGAGGTGGGGAAGGAAGTGGG + Intergenic
1028581187 7:92411174-92411196 ACTGAGGAGCATAAGGCAGAAGG + Intergenic
1029405709 7:100373155-100373177 AGAGAGGAGGAGAAGGAAGCCGG - Intronic
1029406150 7:100374980-100375002 GCAGAGGGGGAGAAGGAAGTGGG - Intronic
1030123894 7:106136657-106136679 ACTGAGGAGCAACAGGACTTAGG - Intergenic
1030518707 7:110569570-110569592 ACTGACAAGCAGAAAGAAGGAGG - Intergenic
1031107497 7:117563070-117563092 AGTGAGGAGCAGAATTAAGGTGG + Intronic
1031870983 7:127090078-127090100 AATGAGGGCCAGAAGCAAGTTGG - Intronic
1031877695 7:127160738-127160760 AGGGAGGATCAGAAGCAAGTGGG + Intronic
1031889648 7:127279179-127279201 ACTGAGGAGGAGGAGGAAGACGG - Intergenic
1033116775 7:138632521-138632543 AGTGGGGAGGAGGAGGAAGTGGG + Intronic
1034024837 7:147689535-147689557 ACAGAGGAGCAGAAAGAAATCGG - Intronic
1034440015 7:151081579-151081601 ACTGAGGAGCAGGGTGAAGCCGG + Exonic
1034978910 7:155463435-155463457 AAGGAGGAGCAGGAGGAAGGAGG - Exonic
1035117352 7:156535827-156535849 ATTGAGCAGCAGGAGGAATTTGG - Intergenic
1035281919 7:157784073-157784095 GCAGAGGAGGAGAAGGAAGCTGG + Intronic
1036625969 8:10471789-10471811 ACTGAGGGGCATAAGGAAGAGGG + Intergenic
1036962461 8:13259992-13260014 AATGAAAAGCAGAAGGAATTTGG + Intronic
1037968975 8:23158215-23158237 ACTGAGGGGCATAAGGCAGAAGG - Intronic
1038005385 8:23425327-23425349 TCTGAGGGGCATAAGGTAGTGGG + Intronic
1038425895 8:27463498-27463520 AGTGATGAGCAGCAGGAAGACGG + Exonic
1038632371 8:29258282-29258304 AATGGGAAGCATAAGGAAGTCGG - Intronic
1039729094 8:40255432-40255454 ACGGAGGGGCAGAAGGCAGAAGG + Intergenic
1041179294 8:55230942-55230964 ACTGAGCAGCTGAAGGCAGGAGG - Intronic
1041291160 8:56310104-56310126 AAGGAGGAGGAGAAGGAAGGAGG + Intronic
1041375103 8:57204606-57204628 ACTGAGGGGCACAAGGCAGAGGG + Intergenic
1041525819 8:58804366-58804388 GCTGAGGAGGAGGAGGAAGAAGG - Intergenic
1041827115 8:62108629-62108651 AGAGAGGAGAGGAAGGAAGTCGG + Intergenic
1042137370 8:65645005-65645027 CCGGAGGAGCTGAGGGAAGTCGG + Intronic
1042889339 8:73589985-73590007 AGGGAGGAGGAGAAGGAAGAGGG + Intronic
1043599581 8:81920666-81920688 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1044085511 8:87937765-87937787 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1044086540 8:87949333-87949355 ACTGAAGAGCAGATGGCTGTAGG - Intergenic
1044296228 8:90530428-90530450 ATTAAGGAGCAAGAGGAAGTTGG + Intergenic
1044416265 8:91943859-91943881 GCTGAAGAGGAGGAGGAAGTGGG + Intergenic
1044954268 8:97463179-97463201 ACTGAGCAGAACCAGGAAGTGGG - Intergenic
1045186265 8:99841657-99841679 ACTGAGAAGCAGTAGGCAGAAGG - Intronic
1045400247 8:101808741-101808763 ACTGTAGACCATAAGGAAGTGGG + Intronic
1045810693 8:106216654-106216676 ACTGAGGACAAGAACGAAGCTGG - Intergenic
1046129658 8:109951491-109951513 ACTAGAGAGCAGAAGGAAGGAGG - Intergenic
1046132775 8:109988612-109988634 ACTGAGCAGCAAAAACAAGTAGG - Intergenic
1046386975 8:113518530-113518552 ACTGAGGGACATAAGGCAGTGGG - Intergenic
1046604669 8:116357905-116357927 ACTTTGGAACAGAAAGAAGTGGG + Intergenic
1047309044 8:123676828-123676850 CCTGTGCAGCAGAAGGAAGTGGG + Intergenic
1047904279 8:129456359-129456381 ACTGTGGGGCACAAGGAAGGGGG - Intergenic
1047932118 8:129739112-129739134 GCTGAAGACCTGAAGGAAGTGGG + Intergenic
1049210776 8:141385478-141385500 AGCGAGGAACAGAAGGAAGAAGG - Intergenic
1049751950 8:144289090-144289112 ACTGAGGAGCAGGTGCAGGTGGG - Exonic
1051308385 9:15741286-15741308 GCTGAGGAGAAGAAGGAATAAGG - Intronic
1052302817 9:26973172-26973194 ACTGATGATCATAAGGAATTTGG + Intronic
1052504065 9:29329901-29329923 ACAGGGTAGCATAAGGAAGTGGG + Intergenic
1053162140 9:35820494-35820516 CCTGAAGAGGAGAAGGAGGTTGG + Intronic
1053476610 9:38386450-38386472 ACTGAGGCCCAGAGGGAGGTAGG + Intergenic
1055307298 9:74943046-74943068 TGACAGGAGCAGAAGGAAGTGGG + Intergenic
1056919400 9:90772742-90772764 ACTGAGAAGCAGGAAGGAGTAGG + Intergenic
1057847506 9:98536893-98536915 ACTGAGGAGCAGGATGGAGAAGG - Intronic
1058278397 9:103077559-103077581 ACTGAGGAGGAGGAAAAAGTGGG + Intergenic
1058354424 9:104066071-104066093 GCTGAGGTGCAGAAGGATGAAGG - Intergenic
1058695601 9:107556620-107556642 GCTGAGGAGGAGGAGGAAGCAGG - Intergenic
1058842937 9:108927896-108927918 AGTGAGGGGCTGAGGGAAGTTGG + Intronic
1058994952 9:110290629-110290651 AGTGAGAAGCAGACAGAAGTGGG - Intergenic
1059072432 9:111152850-111152872 AAGGAGGAGGAGGAGGAAGTAGG + Intergenic
1059396249 9:114035776-114035798 ACAGAGAAGCAGGAGGAAGTGGG - Intronic
1060290788 9:122300661-122300683 AGTGAGGAAGAGAAGGAAGGAGG - Intronic
1060299395 9:122366073-122366095 ACTATGGTGGAGAAGGAAGTGGG + Intergenic
1060371842 9:123081018-123081040 GCTGAGGAGGAGGAGGAAGAGGG - Intronic
1061136875 9:128739817-128739839 ACAGAAGACCAGAAGGAAGGTGG + Intronic
1061705134 9:132447225-132447247 ACTAATGAGCAGAAGAAACTTGG + Intronic
1062166992 9:135112836-135112858 CCTGAGGGGGAGAAGGAAGGGGG + Intronic
1062645222 9:137544345-137544367 ACCGAGGGGCAGCAGGCAGTGGG - Intronic
1062686259 9:137814986-137815008 GCTGAGGAGGAGACGGGAGTGGG + Intronic
1062726451 9:138076655-138076677 ACTTGGGAGCAGAAGGGAGGTGG + Intronic
1203443563 Un_GL000219v1:33763-33785 ACTGAAGACCAGAAGGCTGTGGG + Intergenic
1203514371 Un_KI270741v1:152672-152694 ACTGAAGACCAGAAGGCTGTGGG + Intergenic
1203543346 Un_KI270743v1:110040-110062 ACTGAGGGTCAGAAAGAAGCCGG + Intergenic
1185772188 X:2773265-2773287 ACTGAGGGGAGGAAGGAAGAAGG + Intronic
1185969627 X:4648013-4648035 ACAGAGGAGCACAAGGTAGAAGG + Intergenic
1186229304 X:7436445-7436467 ACTGGGGAGCAAAATGAAGGGGG - Intergenic
1186697827 X:12055968-12055990 AATGAGGAGGAGGAGGAACTTGG - Intergenic
1187511913 X:19927384-19927406 ACGGATGAGTAGAATGAAGTTGG - Intronic
1188284490 X:28311498-28311520 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1188633141 X:32393326-32393348 ACTGAAGAGCATAAGGAGTTTGG + Intronic
1188883345 X:35518061-35518083 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1189533644 X:41913034-41913056 ACCTAGTAGGAGAAGGAAGTTGG - Intronic
1190795039 X:53733056-53733078 ACTGAGGAGGAGGAAGAAGAGGG - Intergenic
1192256497 X:69465127-69465149 ACTGAGTAGCAGCAGCAAGGAGG - Intergenic
1192434271 X:71133225-71133247 GCTGGGGAGAAGAAGGAAGAGGG + Intronic
1192441458 X:71177595-71177617 AGTGGGGAGGAGAAGGGAGTGGG + Intergenic
1192564028 X:72147755-72147777 TCTTAGGAGGAGAAGGAAGTAGG - Intergenic
1193481192 X:82031460-82031482 ACTGAAGACCAAAAGGCAGTGGG + Intergenic
1193641083 X:84009974-84009996 TCTGAGGAGCTGACAGAAGTAGG + Intergenic
1193746434 X:85288228-85288250 ACTGAGGGGCAGGAGGTAGTTGG - Intronic
1194079434 X:89440496-89440518 ACTGAGAAGGAGAAAGCAGTTGG + Intergenic
1194123005 X:89982680-89982702 GATGAAGAGCAGAAGGCAGTGGG + Intergenic
1194160134 X:90438884-90438906 ACTGAGGAGCCTAAGGTAGAAGG + Intergenic
1194215237 X:91123336-91123358 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1194386463 X:93261634-93261656 GCTTACGAGCACAAGGAAGTAGG - Intergenic
1194627595 X:96243664-96243686 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1194629164 X:96262129-96262151 TCAGAGGAGCAGAATGAATTTGG + Intergenic
1195976479 X:110532880-110532902 GCTGAAGAGCAGAAGGCAGTGGG - Intergenic
1196050325 X:111297596-111297618 ACTGTGGAGGAGAAGGAGGAAGG + Exonic
1196141102 X:112264674-112264696 AATGAGGAAGAGAAGGAAGATGG - Intergenic
1196753973 X:119141851-119141873 AGTTAGGAGATGAAGGAAGTAGG + Intronic
1197494124 X:127155850-127155872 TTTGAAGACCAGAAGGAAGTGGG - Intergenic
1197743772 X:129916406-129916428 ACTGAGTTGCAGAATGAAGGGGG - Intronic
1197813883 X:130476831-130476853 GCTAAGCAGCAGAGGGAAGTTGG + Intergenic
1197837688 X:130712842-130712864 ACTGAGGGGCATAAGGAAGAAGG - Intronic
1198957790 X:142150665-142150687 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1199774192 X:150996524-150996546 AGTGAGGAGCAGAAGCAGGTTGG + Intergenic
1199991398 X:152989577-152989599 AAGGAGGAGCAGGAGGAAGAGGG - Exonic
1200049754 X:153422497-153422519 TCTGGGGAGCAGAAGGCAGTGGG - Intergenic
1200105699 X:153710865-153710887 ATCGGGGAGCAGAAGGAAGAGGG - Intronic
1200432052 Y:3095801-3095823 ACTGAGAAGGAGAAAGCAGTTGG + Intergenic
1200464184 Y:3494605-3494627 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1200475864 Y:3640116-3640138 GATGAAGAGCAGAAGGCAGTGGG + Intergenic
1200506427 Y:4015836-4015858 ACTGAGGAGCCTAAGGTAGAAGG + Intergenic
1200517700 Y:4166663-4166685 ACAGAGGAGAGGAAGGGAGTGGG + Intergenic
1201564595 Y:15353177-15353199 AGTGAGCAGCAGAAGCAAGTTGG + Intergenic
1202576415 Y:26331240-26331262 ACTGTGGAGCAGAAAGAACCTGG + Intergenic