ID: 1125584507

View in Genome Browser
Species Human (GRCh38)
Location 15:40810519-40810541
Sequence CAGGGCCCACATAATCAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 88}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125584507_1125584512 -2 Left 1125584507 15:40810519-40810541 CCTACTTGATTATGTGGGCCCTG 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1125584512 15:40810540-40810562 TGGATCCCTCTCCTTTCCCTGGG 0: 1
1: 0
2: 3
3: 30
4: 315
1125584507_1125584511 -3 Left 1125584507 15:40810519-40810541 CCTACTTGATTATGTGGGCCCTG 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1125584511 15:40810539-40810561 CTGGATCCCTCTCCTTTCCCTGG 0: 1
1: 0
2: 2
3: 43
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125584507 Original CRISPR CAGGGCCCACATAATCAAGT AGG (reversed) Intronic
906572629 1:46857261-46857283 AAGGGCACACATAATGTAGTAGG + Intergenic
906599145 1:47108630-47108652 AAGGGCACACATAATGTAGTAGG - Intronic
909223058 1:72986367-72986389 CAAGGAACACATATTCAAGTTGG + Intergenic
909869026 1:80715067-80715089 CAGGTCCAACATAATCACATCGG - Intergenic
916797323 1:168179146-168179168 CAAGACCCACATCATGAAGTCGG + Exonic
916882702 1:169035447-169035469 CTGGGCTCACATAATTATGTGGG + Intergenic
918736902 1:188075741-188075763 AAAAGCCCACACAATCAAGTGGG - Intergenic
920183356 1:204146206-204146228 CAGGGCCCTCAGAATGAGGTGGG - Intronic
1065025171 10:21534339-21534361 GAGGGCACACATAATCAAGAGGG - Exonic
1068790241 10:61021633-61021655 CAGGTCCCTCATAATCAACATGG - Intergenic
1071220319 10:83458366-83458388 TAGGTCCCAAATAGTCAAGTTGG + Intergenic
1072038536 10:91586316-91586338 CTGGGCACTCATAATCAATTGGG - Intergenic
1072508213 10:96091070-96091092 CAGTACTCACATAATAAAGTGGG + Intergenic
1077625998 11:3771873-3771895 AAGGGCCCACAGAACCAGGTGGG - Exonic
1081708931 11:45204766-45204788 CAGGGCTCACCTCATCCAGTTGG - Exonic
1082793808 11:57365699-57365721 CAGAGGCCACATTAACAAGTGGG + Intronic
1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG + Intronic
1086108150 11:83169243-83169265 GAGGGACAACATAATCAACTTGG + Exonic
1088987673 11:114924462-114924484 CAGGGCCTTTATTATCAAGTGGG - Intergenic
1091042519 11:132295342-132295364 AAGGGGCCACATGATCATGTGGG - Intronic
1091265772 11:134270040-134270062 CAGGGGCCAGAGAATGAAGTGGG + Intergenic
1091566401 12:1651842-1651864 CAGAGAACACATAATCCAGTTGG + Intergenic
1095115014 12:38343232-38343254 CAGGTGCCACATAATGATGTCGG - Intergenic
1099625881 12:85073008-85073030 CAGGACCAACATAATCCAGTTGG - Exonic
1107420228 13:40239393-40239415 CATGGCCACCATAATCATGTGGG - Intergenic
1111817583 13:93173119-93173141 AAGGGGCCACATAACAAAGTTGG + Intergenic
1112402741 13:99089637-99089659 TAGGGCCCACCTATTCCAGTAGG - Intergenic
1112656516 13:101457322-101457344 CAAGGCCCAAAAAGTCAAGTAGG + Intronic
1113004314 13:105681122-105681144 CAGGGCCCATATCAGCAAATTGG + Intergenic
1117014468 14:51504695-51504717 CTGGGCCCAGAGAATCAAATGGG + Intronic
1117615304 14:57528294-57528316 CATGGCCCACATATTCAAAAGGG + Intergenic
1119350604 14:73961626-73961648 CAGGGCCCACAGTAGCAAGAGGG + Intronic
1119575273 14:75715295-75715317 CAGGGCCCACATGAGGAAGATGG - Intronic
1121724636 14:96138251-96138273 TAGGGCCCACAGACCCAAGTGGG + Intergenic
1124452714 15:29811172-29811194 CAGGGGCCAAATAATCCACTAGG + Intronic
1125584507 15:40810519-40810541 CAGGGCCCACATAATCAAGTAGG - Intronic
1126075154 15:44901901-44901923 CATGGCCCACATTATACAGTTGG - Intergenic
1126083209 15:44985906-44985928 CATGGCCCACATTATACAGTTGG + Intergenic
1129155942 15:73717968-73717990 CTCGGCCCACATAATCCACTAGG - Intergenic
1130683405 15:86016103-86016125 CAGGGCCCACATCACTAAATAGG + Intergenic
1135579906 16:23616578-23616600 CAGGGCCCCTATAATCTAGTAGG - Intronic
1136774733 16:32865784-32865806 CAGGGCCAACCATATCAAGTGGG - Intergenic
1136895881 16:33995728-33995750 CAGGGCCAACCATATCAAGTGGG + Intergenic
1138143057 16:54585053-54585075 CAGGGCTGAAATAATCAACTAGG + Intergenic
1140911428 16:79456463-79456485 AGGGGTCCACATAATCCAGTGGG + Intergenic
1203077160 16_KI270728v1_random:1127920-1127942 CAGGGCCAACCATATCAAGTGGG - Intergenic
1149947344 17:60944511-60944533 CAGGCCTCAAATAATCAAATGGG - Intronic
1150927469 17:69548269-69548291 CAGGGCCCATAAATTCAACTAGG - Intergenic
1151948125 17:77330406-77330428 CAGGGCCCACATCAACATGAGGG - Intronic
1155198644 18:23498738-23498760 CAGGCCCCACAGAATCTAGAGGG - Intergenic
1159557823 18:69963302-69963324 CAAGGAACACATATTCAAGTTGG - Intergenic
1164723837 19:30452191-30452213 CAGGGCTCACATAACACAGTGGG - Intronic
925660688 2:6199109-6199131 CAGGGGCCAGATTATTAAGTGGG + Intergenic
929685736 2:44032592-44032614 CTGGTCCCACAAAAACAAGTGGG - Intergenic
930409990 2:51013265-51013287 CAGGGCAAACATAAGCATGTGGG + Intronic
939166525 2:138646741-138646763 CAGTTCCCACCTAATCAAATTGG + Intergenic
940241276 2:151565751-151565773 CATGGTCCACAGAATCCAGTGGG + Exonic
940812720 2:158263444-158263466 CAGGGAGCATATAATCTAGTTGG - Intronic
945011084 2:205464426-205464448 CTGGGACCACACAATCTAGTGGG + Intronic
946213674 2:218167109-218167131 CAGGGTCCATATGACCAAGTGGG + Intergenic
947451370 2:230212077-230212099 TAAGGCCCCCATAATCAGGTGGG + Intronic
1169780231 20:9301646-9301668 GAGGGGCCAAATATTCAAGTAGG - Intronic
1170980681 20:21209228-21209250 CAGTGCCCACATAACCTATTAGG + Intronic
1178231025 21:30784855-30784877 CAGTGACCACATCTTCAAGTCGG - Intergenic
1179347109 21:40568911-40568933 CAGGGCCCACATATTCCCATGGG + Intronic
1180056085 21:45359898-45359920 CAGTTCCCACATAATGAATTCGG - Intergenic
950016598 3:9758984-9759006 CAGTGCCCTCAGGATCAAGTTGG + Intronic
950847726 3:16031163-16031185 CAGGGGACACAGAGTCAAGTAGG - Intergenic
952919403 3:38274754-38274776 CAGGGCCCAGACACTCACGTAGG - Exonic
956747901 3:72324023-72324045 CAGTGCCCACACGGTCAAGTGGG - Intergenic
960679891 3:120237072-120237094 AAGGAACCACATAAGCAAGTTGG - Intronic
967447993 3:189589457-189589479 AAGGTCCCTTATAATCAAGTTGG - Intergenic
967805472 3:193711396-193711418 CAGGGCCCACACATTCAGGGAGG - Intergenic
971336448 4:25727906-25727928 GAGGGCCCACAGAATCAGGAAGG - Intergenic
972046134 4:34666730-34666752 CATGGCCTCCATAATCAAGTGGG - Intergenic
973626981 4:52782760-52782782 AAAGGCCCACATATTCAAGGAGG + Intergenic
987017328 5:13834101-13834123 CACTTCCCACATAATCAAGTTGG + Intronic
988163088 5:27546790-27546812 CAAGGCACATATAATCACGTAGG + Intergenic
989654144 5:43726465-43726487 CAGGGCCCAATTAATTAAGTAGG + Intergenic
990642817 5:57806864-57806886 CAGGGCCACCATACGCAAGTGGG + Intergenic
990716849 5:58646820-58646842 CATGGCCGACATATTCAATTAGG + Intronic
999711267 5:154320642-154320664 GAAGGCCAACATAATGAAGTTGG + Intronic
1005493131 6:26365306-26365328 CAGAGCCCACAGAATAAAGACGG - Exonic
1009513529 6:64583400-64583422 CAGGGCCCAAATAAGCAAGCAGG + Intronic
1018036518 6:159887047-159887069 CCGGGCCAACATAATAAAGATGG - Intergenic
1027144461 7:75684545-75684567 CTGGGCCCAAAAAAGCAAGTGGG - Intronic
1027505970 7:79017250-79017272 CAGGGGCCACAGAATAAAGCTGG + Intronic
1028854965 7:95580538-95580560 CAGGGAACACACAATCTAGTTGG + Intergenic
1029233524 7:99091883-99091905 CAGGTCCCAGATGATGAAGTTGG - Intronic
1037121378 8:15291243-15291265 AAGGGTCCTCAAAATCAAGTAGG - Intergenic
1039947848 8:42145363-42145385 CAGGGGGCACATACTCTAGTGGG + Intergenic
1041632956 8:60108704-60108726 CAGTGCCTACAAAATCAAGCAGG - Intergenic
1044601768 8:94012264-94012286 CAAGGGCCACATAATAAACTTGG - Intergenic
1049853692 8:144848713-144848735 CAGGGCAGACATGATCCAGTTGG - Intronic
1058700844 9:107598846-107598868 CAAAGCCCTCATAATCTAGTGGG + Intergenic
1059365656 9:113784700-113784722 CAGGGCCCAAAGAAGCAAGCAGG + Intergenic
1188920368 X:35968449-35968471 CAGGGCCCAGATAAGCATGTCGG - Intronic