ID: 1125584510

View in Genome Browser
Species Human (GRCh38)
Location 15:40810538-40810560
Sequence CAGGGAAAGGAGAGGGATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 614
Summary {0: 1, 1: 0, 2: 3, 3: 55, 4: 555}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125584510_1125584519 25 Left 1125584510 15:40810538-40810560 CCTGGATCCCTCTCCTTTCCCTG 0: 1
1: 0
2: 3
3: 55
4: 555
Right 1125584519 15:40810586-40810608 TCCCTGACCTAGACTGCTTCTGG 0: 1
1: 0
2: 1
3: 11
4: 115
1125584510_1125584521 26 Left 1125584510 15:40810538-40810560 CCTGGATCCCTCTCCTTTCCCTG 0: 1
1: 0
2: 3
3: 55
4: 555
Right 1125584521 15:40810587-40810609 CCCTGACCTAGACTGCTTCTGGG 0: 1
1: 0
2: 2
3: 16
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125584510 Original CRISPR CAGGGAAAGGAGAGGGATCC AGG (reversed) Intronic
900287691 1:1909305-1909327 CGGGGAAAGGCGGGGGAGCCCGG - Intergenic
900558237 1:3290682-3290704 CAGGGAAACAACAGGGCTCCAGG + Intronic
900622763 1:3594944-3594966 CAGGGCAGGGAGAGGGACTCAGG + Intronic
900732144 1:4269075-4269097 CAGGGAGAGGAGAGGCAGCCAGG + Intergenic
900750914 1:4396854-4396876 CAGGAACAGGCCAGGGATCCAGG + Intergenic
900814137 1:4830396-4830418 CTGGGAAAGGGGGGGCATCCTGG - Intergenic
900932906 1:5747861-5747883 AAGGGAAAGGGGAGGGAGGCAGG + Intergenic
900992832 1:6105877-6105899 CAGGGGCAGGACAGGGCTCCAGG + Intronic
901040190 1:6358874-6358896 CAGAGAAAGGCGAGGGAGCAGGG + Intronic
901212390 1:7534019-7534041 CAGGGTCAGGAGAAGGCTCCAGG - Intronic
901561440 1:10074732-10074754 CAGGGAAATGAAAAGGAACCAGG - Intronic
901653713 1:10757292-10757314 CAAGGAAAAGAGAGGGCCCCAGG - Intronic
901761793 1:11476773-11476795 CAGGGGAAGGGGAGGAAACCTGG + Intergenic
902558308 1:17260185-17260207 CAGGGACAGGGGAGGGACACCGG + Intronic
902606342 1:17571409-17571431 CAGGGACAGGAGACGGAGCATGG + Intronic
902649631 1:17828228-17828250 CAGGGAAAAGAGTGGGGGCCTGG + Intergenic
903123884 1:21234832-21234854 CAGGGACAGGACATGGATCCTGG + Intronic
903559321 1:24216135-24216157 GAGGGAAAGAAGAGGAATCCAGG + Intergenic
904571670 1:31470737-31470759 CAGGGATAGGAGAAGGGTCTGGG + Intergenic
905044013 1:34982438-34982460 AAAGGAAAGGAGAAGGATCAGGG - Intronic
905046576 1:35008185-35008207 AAGGAAAAGGAGAGAGGTCCAGG - Intronic
905125727 1:35714928-35714950 AAGGGAAAGGAGAGGTGGCCTGG + Exonic
905322107 1:37125200-37125222 CAGGGAAAAGAAAGGCATTCTGG - Intergenic
905417433 1:37813640-37813662 CAGGGCAAGGAAAGGGCTCTTGG + Exonic
905454400 1:38077927-38077949 CAGGGCAAGGAAGGGGAGCCTGG - Intergenic
906145691 1:43558780-43558802 GAGGGAAAGGCCAGGAATCCAGG - Intronic
906484254 1:46222123-46222145 CTGGAAAAGGAGAGGGAGCAAGG + Intergenic
906579765 1:46927039-46927061 CTGGGAAAGGAGAGTGACCTGGG - Intergenic
907429783 1:54405467-54405489 CAGGGAAGGGAGAGCGCTCCCGG + Intronic
908450343 1:64248196-64248218 GAGGGACAGGAGAGGGAGCAAGG - Intronic
908555852 1:65255502-65255524 AAGGGGAAAGAGAGGGATGCAGG + Intronic
908793100 1:67802657-67802679 CAGGGCAAAGAGAGGTAGCCTGG - Intronic
908909834 1:69060328-69060350 AAGAGAAAGGAGGGGGAACCAGG + Intergenic
909607193 1:77519417-77519439 TAGGGAAAAGAGTGGGCTCCAGG - Intronic
910340837 1:86185087-86185109 CAGGCAATGGAGAAGGATCAAGG + Intergenic
911778451 1:101844344-101844366 GAGGGAAAGAAGAAGAATCCAGG + Intronic
912445457 1:109732648-109732670 CAGGGAAAGGAGAGAGGGACAGG - Intronic
913650145 1:120905861-120905883 CAGGGAAAGGAAAAGGATTTGGG + Intergenic
914076528 1:144357644-144357666 CAGGGAAAGGAAAAGGATTTGGG - Intergenic
914102650 1:144608853-144608875 CAGGGAAAGGAAAAGGATTTGGG + Intergenic
914170975 1:145223224-145223246 CAGGGAAAGGAAAAGGATTTGGG - Intergenic
914526089 1:148467192-148467214 CAGGGAAAGGAAAAGGATTTGGG - Intergenic
914640314 1:149599931-149599953 CAGGGAAAGGAAAAGGATTTGGG + Intergenic
915341598 1:155179535-155179557 AAGGGAAAGCAGCGGGAGCCGGG - Intronic
915393393 1:155563365-155563387 GAGGGAAAGGAGCGGGACTCCGG + Intergenic
915409516 1:155689210-155689232 GAGGGAAAGGAGCGGGACTCCGG + Intronic
918059958 1:181052507-181052529 CAGGGTAAGGACGGGGATCGTGG + Exonic
918148877 1:181781348-181781370 CAGGGAAAGGAGAAGGAAGTGGG - Intronic
918177819 1:182060780-182060802 CAGGGACAGCAAAGGGATGCTGG + Intronic
918453697 1:184685645-184685667 CAGGAAAAAGAGAAGGCTCCTGG - Intergenic
919991279 1:202709903-202709925 CAGGGAAAGGAGAGAGGGACGGG + Intronic
920832959 1:209481787-209481809 CAGGGAGAGGACAGTGAACCAGG - Intergenic
920951290 1:210573913-210573935 CAGGGAAATGAGAGGGATGAAGG + Intronic
920966276 1:210704060-210704082 CAGGGCAAGGAGAGGTGCCCTGG + Intronic
922070057 1:222183474-222183496 CAGGGAAAGGGGTGGGATTGTGG - Intergenic
922806194 1:228391318-228391340 CAGGGAAAGCACAGGGATCCGGG + Intergenic
923411008 1:233709051-233709073 CAGGAAAAGGAGAGGAATGGAGG - Intergenic
923942819 1:238846978-238847000 GAGAGAAAGGAGAGAGATCATGG + Intergenic
924266956 1:242291995-242292017 CAGGAAGATGAGAGGGGTCCAGG + Intronic
924502464 1:244650563-244650585 CAAAGAAGGGAGAGGGATCCAGG - Intergenic
924740176 1:246790248-246790270 CAGGGAGGGGAGAGGGCTGCTGG + Intergenic
1062952653 10:1516261-1516283 CTGGGAAAGGAGAGGGCCTCGGG - Intronic
1063228152 10:4035273-4035295 CAGGCAAAGGAGCTGGATGCAGG + Intergenic
1063330083 10:5148980-5149002 CAAGAAAAGGAAAGGAATCCTGG + Intergenic
1063957795 10:11282316-11282338 CAGGGAGAGGACAGGCACCCAGG + Intronic
1064642741 10:17430947-17430969 CAGGGAAAGGAAAGGGGTTTGGG - Intronic
1066215849 10:33286516-33286538 CAGGAAATGGAGAGAGGTCCAGG + Intronic
1066655915 10:37699898-37699920 AAGAGAAACGTGAGGGATCCTGG + Intergenic
1066717861 10:38306501-38306523 CAGGAAGATGAGAGGGGTCCAGG - Intergenic
1067040363 10:42949819-42949841 AAGAGAAACGTGAGGGATCCTGG + Intergenic
1068602422 10:58969716-58969738 GAGGGACAGGAGAGGGATTGTGG + Intergenic
1069929719 10:71874273-71874295 TGGGGAAAAGAGAAGGATCCCGG - Intergenic
1070662419 10:78316787-78316809 CAGGGCAGGCAGAGGGAACCAGG + Intergenic
1070665044 10:78336746-78336768 CAAGGAATGGAGAGGCAGCCTGG + Intergenic
1070835333 10:79444275-79444297 CACGGAAAGGAGTGGTATCTGGG + Intronic
1071479427 10:86053744-86053766 CAGGGAAAGGGGAAAGATGCAGG + Intronic
1071941728 10:90598295-90598317 CTGGGAAACTAGAGGCATCCTGG - Intergenic
1072415245 10:95241776-95241798 CAGGGAAGGGAGAGGCACTCTGG - Intronic
1072745926 10:97939159-97939181 AAGGGAGAGGTGAGGGATCATGG + Intronic
1072886946 10:99285559-99285581 AAGGGAAAGGTGAGGGATGGAGG + Intergenic
1073325433 10:102642242-102642264 CAGGGAAAGGGGGAGGAGCCGGG + Intergenic
1073778226 10:106809441-106809463 CAGGGCTAGCAGGGGGATCCTGG - Intronic
1074298003 10:112209015-112209037 CAGGGCAAGGACAGGGATTGGGG + Intronic
1074405385 10:113176797-113176819 CAGGGGAAGGAGAAGCAGCCAGG - Intergenic
1074712669 10:116190441-116190463 CAGGAGAAGGAAAGGGAGCCTGG + Intronic
1076000134 10:126906756-126906778 CACAGAAAGGAGAGCGCTCCGGG - Intronic
1076534312 10:131167153-131167175 CAGGCACAGGAGAGGGATGCCGG - Intronic
1076642927 10:131931108-131931130 AGGGGAGAGGAGAGGGATGCTGG - Intronic
1077020177 11:413844-413866 CAGGCAGAGGAGAGGGTTCAGGG - Intronic
1077160300 11:1109621-1109643 GAGGGAAAGGAGAATGAGCCCGG - Intergenic
1077350717 11:2091966-2091988 CAGGGAGAGGACAGAGATCCCGG - Intergenic
1077540063 11:3142453-3142475 CAGCGAGTGGGGAGGGATCCTGG - Intronic
1080552246 11:33382809-33382831 CAGGGCAGGGAGAGGGTGCCAGG - Intergenic
1080687080 11:34524728-34524750 CAGGGAGAGGAAAGGGCACCTGG - Intergenic
1081651643 11:44827823-44827845 CAGAGAAAGGAGAGGGACATGGG + Intronic
1081759443 11:45567036-45567058 CAGGGATAGGGAAAGGATCCAGG + Intergenic
1083375229 11:62214809-62214831 CAAGGCAAGGGCAGGGATCCAGG + Intergenic
1083676439 11:64328149-64328171 CAGGAAAGGGACAGGGAACCAGG - Intergenic
1083676671 11:64329734-64329756 CAGGGCAGGGACAGGGAGCCAGG + Intergenic
1083994168 11:66264023-66264045 CTGGGATGGGAGAGGGAGCCAGG - Intronic
1084501925 11:69540161-69540183 CAGGGAAAGGACAAAGACCCTGG + Intergenic
1084667029 11:70582050-70582072 CAGGGAAAGGAGACTGGACCTGG - Intronic
1085447625 11:76611102-76611124 CATGGAGAGGAGAGGGCTGCAGG + Intergenic
1085515334 11:77108273-77108295 CAGGGAAAAGAGAGCCATGCTGG + Intronic
1089478891 11:118790161-118790183 AAGAGAAAGGAGAGAGATACGGG + Intronic
1089777995 11:120852487-120852509 CAGAGAAAGGACAGAGTTCCTGG + Intronic
1089867168 11:121642110-121642132 GAGGGAAAGGAGGAGGATCTGGG + Intergenic
1090065792 11:123502386-123502408 CAGGGAAGGGAGAGGGGGCTAGG - Intergenic
1090172370 11:124616287-124616309 CAGGCCAAGGAGTGGGAACCTGG - Intronic
1090386036 11:126358002-126358024 CAGGGGATGGAGAGGGAGCTTGG + Intronic
1091534362 12:1391591-1391613 CAGGGAAAGCCGAGGGAGGCAGG - Intronic
1091596281 12:1881120-1881142 CAGGGACAGGAGAGGGAAGGAGG + Intronic
1091882498 12:3990900-3990922 CAGGGAAAGCAGAGGCCGCCTGG + Intergenic
1095678629 12:44948947-44948969 CCGTGAAAGGAAAGGGCTCCAGG + Intergenic
1095760738 12:45832635-45832657 CAGGAAAAGAAGAGGGGTCTGGG - Intronic
1096226662 12:49870439-49870461 CAGGGGAGGGACAGGGAACCAGG + Exonic
1096553934 12:52391646-52391668 CAGGGAGTGGAGCTGGATCCAGG + Intergenic
1096676563 12:53229575-53229597 AAGGAAAAGGAGAGGGACCCTGG - Intronic
1097672275 12:62554809-62554831 AAAGGTAAGGAGAGGGGTCCAGG - Intronic
1098786054 12:74757003-74757025 CAGGAAAAGGACACGGATCCAGG + Intergenic
1099933032 12:89095445-89095467 CAGACAAAGGAGAGAGATCTCGG + Intergenic
1100515654 12:95325127-95325149 CAGGGATAGGGGAGGGAGCACGG - Intergenic
1100768814 12:97898561-97898583 CAGGGAAGTGGAAGGGATCCAGG - Intergenic
1102761906 12:115394902-115394924 CAGGGAAAGAAGAGTGAGCAAGG + Intergenic
1103091705 12:118102781-118102803 CAGGGAGAGGAGATGGAGCCAGG - Intronic
1104289605 12:127455713-127455735 CAGGGAAAGGGGCGGGTTCGGGG + Intergenic
1105963914 13:25368087-25368109 GAGGGAAAGGAAAGGGATTAGGG + Intergenic
1106112534 13:26789594-26789616 CAGTGAAATGAGAGGACTCCTGG - Intergenic
1106230139 13:27815270-27815292 CAGGGAAAGGAGAGGCCCGCGGG - Intergenic
1106661015 13:31799608-31799630 CAGGGGCAGGAGAGGAACCCAGG - Intronic
1106890613 13:34241777-34241799 TAAGGAAAGGAGAGAGACCCTGG - Intergenic
1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG + Intergenic
1110142299 13:72145430-72145452 CAAGCAGAGGACAGGGATCCAGG + Intergenic
1111898166 13:94167639-94167661 GAGGGAAGGGAGAGTGTTCCAGG + Intronic
1112225303 13:97533641-97533663 CAGGGAAAGAGCAGGGATTCTGG + Intergenic
1113766981 13:112887891-112887913 CAGGGAGAGGAGATGTAGCCAGG - Intergenic
1113767958 13:112892735-112892757 AGGGGACAGGAGAGGGGTCCAGG - Intergenic
1114320020 14:21539457-21539479 GAGGGGAAGGAGAGGGATAGAGG + Intergenic
1114461983 14:22892319-22892341 CAGAGAAAGAAGAGGGAACAAGG + Intergenic
1114568188 14:23647585-23647607 CCTGGAAAGGAGCGGGAGCCTGG - Intergenic
1114624287 14:24118608-24118630 CAGGACAAAGTGAGGGATCCTGG - Intronic
1115080370 14:29443709-29443731 CAGGCAAAGCAGAGGGAATCGGG - Intergenic
1117460235 14:55938173-55938195 AAGGGAAAGGAGCTGTATCCTGG + Intergenic
1117606432 14:57433474-57433496 CTGGGAAAGGTGAGGGGTCCGGG - Intergenic
1117665067 14:58047894-58047916 CAGGTAAAGTAGAAGGATCTGGG + Intronic
1118378520 14:65198495-65198517 CAGGCAAAGGAGGGGGATGCTGG + Intergenic
1119381562 14:74232710-74232732 CAAGGAAAGGAAAGGGATGTGGG - Intergenic
1119647621 14:76359720-76359742 CAGGGAAAGCAGAGGGCTTGTGG + Intronic
1119865034 14:77966298-77966320 CAGGCAAAGGGGAGGGAGGCAGG - Intergenic
1120649557 14:87115421-87115443 CAGGGAAAGCAGAGGGAAAAGGG - Intergenic
1121790353 14:96694867-96694889 CAGGGAAAGGTGAGGAATTGGGG + Intergenic
1122174906 14:99909670-99909692 CAGGGAAAGGACCTGGACCCAGG + Intronic
1122215572 14:100201545-100201567 CAGGGAGAGGAGAGGGAGATAGG + Intergenic
1122865712 14:104603185-104603207 CAGGGAGAAGGGAGGGAGCCAGG - Intronic
1123046120 14:105516652-105516674 TAGGGAAATGCAAGGGATCCAGG + Intergenic
1123051115 14:105543623-105543645 CTAGGAGTGGAGAGGGATCCTGG + Intergenic
1123711185 15:22988960-22988982 CAAGGGAAGGAGCAGGATCCGGG - Intronic
1123802910 15:23840115-23840137 CAGGGAATGGAGAGAGAATCAGG + Intergenic
1124338864 15:28876964-28876986 CGGGAAAAGGAGAGGGCTCAGGG - Intergenic
1124428804 15:29588309-29588331 CAGGGAAAAGAAAGGGATAGAGG + Intergenic
1124509827 15:30314306-30314328 CAGAGCAAGGAGAGAGTTCCAGG + Intergenic
1124733064 15:32216248-32216270 CAGAGCAAGGAGAGAGTTCCAGG - Intergenic
1125181197 15:36882459-36882481 CAGGGAGGGGACAGGGACCCCGG - Intergenic
1125584510 15:40810538-40810560 CAGGGAAAGGAGAGGGATCCAGG - Intronic
1126049662 15:44674392-44674414 CAGGAGAGGGAGAGGGATCCTGG - Intronic
1127566499 15:60194280-60194302 CAGGAAGAGGAGAGGGAACAGGG - Intergenic
1128514837 15:68335677-68335699 CAGGTAATGGAGGGGGAGCCTGG - Exonic
1128565953 15:68700486-68700508 CAGGGAGGGGAAACGGATCCTGG - Intronic
1128725012 15:69982002-69982024 AAGGAAAAGGAGAGGGTTTCTGG - Intergenic
1129250407 15:74305633-74305655 CAGGGAAAGGAGAGACAGCTGGG - Intronic
1129254626 15:74327104-74327126 CAGGGCATGGAGAGGGATCTCGG - Intronic
1129713979 15:77836366-77836388 CAGGGAAAGGAGAGAGCAGCTGG - Intergenic
1129977104 15:79831539-79831561 CAGGGGAAGGGGAGGACTCCTGG - Intergenic
1130109758 15:80954474-80954496 CAGGGAAAGGAGTAGGATGTGGG + Intronic
1130863176 15:87909097-87909119 GAAGGAAAGGAGAGGGAATCTGG - Intronic
1131123845 15:89841414-89841436 CAGGGAGAGGACAGGGAAGCTGG + Intronic
1131703649 15:94969168-94969190 CAGGATAAGGAGAGGGAGCTGGG + Intergenic
1132752432 16:1464972-1464994 CAGGGCAAGGACAGGGATCTTGG - Intronic
1133221157 16:4319729-4319751 CAGGGACTGGAGAGGGATCATGG + Intronic
1133230809 16:4365681-4365703 CAGGAAGAGGAGGGGGTTCCTGG - Intronic
1133960292 16:10487227-10487249 CAGGGATAGGAGAAGGGTCTGGG - Intergenic
1134071838 16:11265108-11265130 CAGGGAAGGGAAATGGACCCAGG - Intronic
1134228744 16:12412937-12412959 CAGGAAAGGGAGAGAGAGCCAGG - Intronic
1134233718 16:12449368-12449390 CACGGCAAGGACAGGGATCATGG + Intronic
1135643776 16:24143527-24143549 CAGGGATGGGAGAGGGAGCTAGG + Intronic
1135894440 16:26386138-26386160 CAGGGAAAGCAGAGTGAGGCTGG - Intergenic
1135934533 16:26768415-26768437 CAAGGAAAGGCAGGGGATCCAGG - Intergenic
1136042405 16:27590713-27590735 CAGGGAGAGGAGAAGGCCCCAGG - Intronic
1136107401 16:28040030-28040052 CAGGGGAAGGAGAGGAGTCAGGG - Intronic
1137581991 16:49639178-49639200 TAGGGAAAGGAGGGGCAGCCTGG + Intronic
1137821524 16:51449903-51449925 AAGGGAAAGGAGTGAGACCCCGG - Intergenic
1138433174 16:56982360-56982382 CAGGGAGAGGAAAGGGGGCCAGG - Intronic
1138528769 16:57623617-57623639 CAGGGAAAGAGCAGGGAGCCTGG - Intronic
1139365018 16:66427602-66427624 CTCGGAACGGAGCGGGATCCCGG + Intronic
1140689941 16:77472379-77472401 CAGGGAATGGAAAGGGATTAGGG - Intergenic
1140720672 16:77768936-77768958 CAAGGGAAGGAGAGGGCTCTGGG - Intergenic
1140875977 16:79152898-79152920 CAGGGATAGAAGTGGGCTCCGGG + Intronic
1141164805 16:81653294-81653316 CAGAGAAAGGGGAGGGCTCCAGG - Intronic
1141676843 16:85522235-85522257 CAGGGAAAGAGGTGGGATACTGG - Intergenic
1141832979 16:86520000-86520022 CAGGGCAAGGGGAGGCAGCCAGG + Intergenic
1141865324 16:86746172-86746194 GAGGGAAAGGAGGAGGATCTGGG + Intergenic
1141888061 16:86906641-86906663 CAGGAAAAGGAGAAGTCTCCTGG + Intergenic
1142360443 16:89623811-89623833 GAGGGGAAGAAGAGGGATACGGG + Intronic
1142889271 17:2932423-2932445 CAGGGAGAGGAGAGGGAGGAAGG + Intronic
1142905787 17:3040958-3040980 CAGGGAAACCAGAGAGAGCCAGG - Intergenic
1142956359 17:3525440-3525462 CCGGGAAAGGAGAGGAATAGGGG + Intronic
1143377631 17:6476808-6476830 CAGGGCAGGGACAGGGAACCAGG + Intronic
1143680266 17:8470957-8470979 CTGGGAGAGGGGAGGCATCCTGG + Intronic
1144248704 17:13394336-13394358 CTTGGAAAGGAGAGTGATGCTGG + Intergenic
1145903900 17:28506113-28506135 CAGGGACAGGGGAGGGGGCCTGG + Intronic
1145911541 17:28546244-28546266 GAGGGCAAGGAGATGGCTCCAGG + Intronic
1146631671 17:34474416-34474438 CAGAGAGAGGAGCGGGACCCAGG + Intergenic
1147219475 17:38919994-38920016 CAGTGAGAGGGGAGGGCTCCTGG + Exonic
1147310442 17:39592857-39592879 TAGGGAAAGGAGATGGACCTGGG + Intergenic
1147330417 17:39696037-39696059 CAGGGAAGGGAAAGGGGTGCTGG - Intronic
1147426669 17:40348990-40349012 CAGGGAAAGGAGGAGAAGCCGGG - Intronic
1147496018 17:40916540-40916562 CAAGGAAAGCTGAGGAATCCAGG - Intergenic
1147675378 17:42201870-42201892 GAGGGAAAGAAGAGGGATGAAGG + Intronic
1148075965 17:44935350-44935372 CTGGGAAGGGAGGGGGACCCCGG - Exonic
1148127193 17:45242942-45242964 CAGGGGAAGCACAGGGAGCCTGG - Intronic
1148148958 17:45384870-45384892 CACGGACAGCAGAGGCATCCCGG + Intergenic
1148439827 17:47706224-47706246 CAGGGGAAGGAGAGGGCTCTGGG - Intronic
1148740851 17:49891407-49891429 CAGGGAGAGGAGAGAGGACCTGG + Intergenic
1148756079 17:49973619-49973641 CGAGGAAGGGAAAGGGATCCAGG - Intronic
1148760835 17:49999115-49999137 GAGGGAAAGGAGAGGCTTCCCGG + Intergenic
1149537123 17:57441647-57441669 AAGGGAAAAGAAAGGGACCCTGG - Intronic
1149829649 17:59860938-59860960 CTGGCAAAGGAGAGGCACCCGGG + Intronic
1150140580 17:62725184-62725206 CAGAGAAGGAAGAGGGCTCCTGG + Intronic
1150143739 17:62751022-62751044 GAAAGAAAGGAGAGAGATCCCGG + Intronic
1150720753 17:67612302-67612324 GAGAGAAAGGAGGGTGATCCAGG + Intronic
1150969777 17:70014534-70014556 TTGTGAAAGGAGAGGGATTCAGG - Intergenic
1151389022 17:73773139-73773161 CAAGGAAAGGAGAACGGTCCTGG - Intergenic
1151430162 17:74056823-74056845 AAGAGAGAGGAGAGGGAGCCAGG - Intergenic
1151843464 17:76634370-76634392 CAGGGAGTGGAGAGGGACACAGG - Intronic
1151961412 17:77407854-77407876 CAGGAAAAGAGCAGGGATCCAGG - Intronic
1152036250 17:77874908-77874930 CAGGGAGAGGGGAGGGCGCCAGG + Intergenic
1152111217 17:78358683-78358705 GAGGGGAAGGAGGGGGCTCCAGG + Exonic
1152389184 17:79992648-79992670 CAGGGAGAGGAGAGGCGACCTGG - Intronic
1152399819 17:80059164-80059186 CAGGGAAGGAATAGGAATCCGGG - Intronic
1153505299 18:5790595-5790617 CAAGGAATGGAGAGGGCTGCTGG + Intergenic
1153893844 18:9541601-9541623 GAGGGGAGGGAGAGGGAGCCAGG - Intergenic
1154114814 18:11604101-11604123 CAGAGCAAGGAAAGGTATCCGGG + Intergenic
1154132941 18:11751816-11751838 CGGGGAAGGGAGAGGGAGGCTGG - Intronic
1154167531 18:12027254-12027276 CAGGGACAGGAGCAGAATCCCGG + Intronic
1154315507 18:13300549-13300571 CAGGAGAAGGAGAGGGTTCCGGG - Intronic
1155078836 18:22387759-22387781 CAGGGGAAGGATAGAGATCATGG - Intergenic
1155526527 18:26721514-26721536 CAGGGAAAGCCTAGGGATGCAGG - Intergenic
1155680852 18:28483698-28483720 CAGGGAAAGAAGTGGGAGGCAGG + Intergenic
1156054044 18:32976377-32976399 CAGGGACAGGAGAAGGGTCTGGG + Intronic
1156305893 18:35877788-35877810 CATGGGAAGGAGAGTCATCCAGG - Intergenic
1157713634 18:49867067-49867089 CAGGGAAGGAAGCTGGATCCAGG + Intronic
1159136150 18:64338925-64338947 CTGGGAATGAAGAGAGATCCTGG + Intergenic
1159214456 18:65372357-65372379 GAGGGAGAGGAGAGGGTGCCAGG + Intergenic
1159222996 18:65489551-65489573 CATTGAAAGGTGAGGGATCTAGG + Intergenic
1159599589 18:70416206-70416228 CAGGGAACGGGGAGGGAGACAGG + Intergenic
1160553504 18:79711402-79711424 CAGGGAATGGCCAGGGCTCCTGG + Intronic
1160736594 19:665430-665452 CAGGGGAAGGAGAGGGGACTTGG - Intergenic
1161419324 19:4167642-4167664 CAGGGAAAGGTGATGTTTCCAGG + Intronic
1162349279 19:10138919-10138941 CAGGGAAGCGACAGGGCTCCTGG - Intronic
1162438762 19:10679954-10679976 CAGGGAAAGGACAGGGTTCCAGG + Intronic
1163210523 19:15836725-15836747 CAGGGACAGGACAGGACTCCCGG + Intergenic
1163350974 19:16776993-16777015 GAGGGAAAGGAGAGGGAAGAGGG + Intronic
1163668084 19:18612443-18612465 CAGGGAACGGAGAGGGAGGAAGG - Intronic
1163759802 19:19130040-19130062 TAGGCAAAGGAGTGGGCTCCTGG - Intronic
1163933823 19:20423906-20423928 CAGGGAAAGAAGAGGGAAGAAGG + Intergenic
1164056189 19:21623885-21623907 CAGGGAAAGGAAAGGGGACAAGG + Intergenic
1164552404 19:29222446-29222468 CAGACAAGGTAGAGGGATCCTGG + Intergenic
1164876349 19:31693437-31693459 CAGGGAAATGACAGGGTTGCTGG - Intergenic
1166289083 19:41850376-41850398 CTGGGAAAGAAGTGGGATCTAGG + Intronic
1166302753 19:41921689-41921711 CAGAGGCAGGAGAGGGATGCAGG + Intronic
1166305777 19:41936214-41936236 CAGGGAAGGCCGAGGGATCCAGG - Intergenic
1166850136 19:45755992-45756014 CAGGGAAAGGTGCGTCATCCTGG - Exonic
1167088147 19:47324474-47324496 GAGGCCAAGGAGTGGGATCCAGG + Intergenic
1167379564 19:49130626-49130648 TACGGAAAGGCGAGGGACCCAGG - Intronic
1167738141 19:51310174-51310196 CAGTGAAAGAACAGGGAGCCAGG + Intergenic
1168001313 19:53448407-53448429 CAGGGAAAGGAGATGCATTATGG - Intronic
1168557959 19:57359213-57359235 CAGTGACAGAAGAGAGATCCAGG + Exonic
1168583067 19:57571324-57571346 CAGAGAAAGTGTAGGGATCCAGG + Intergenic
1168585950 19:57592034-57592056 CACAGAAAGAATAGGGATCCAGG - Exonic
924967292 2:90743-90765 CAGGGAAACATGAGGGATCAGGG + Intergenic
925034555 2:675802-675824 CAGGAAAGGGAGAAGGAACCAGG + Intronic
925077378 2:1028591-1028613 AAGGGAAAGCAGAGGGTTTCTGG - Intronic
926503046 2:13678463-13678485 CAGGGATAGGAGAAGGGTCTGGG - Intergenic
928124349 2:28605535-28605557 CAGATGAAGGAGTGGGATCCTGG - Intronic
929261343 2:39870054-39870076 CAGGAAAAGGAAGGGGATTCTGG - Intergenic
929292397 2:40208472-40208494 GAGGGAATGGAGAGAGATTCTGG + Intronic
930606570 2:53499199-53499221 CGGGGAAAAGAGAGGGAGGCAGG + Intergenic
930673573 2:54176942-54176964 CTGTGAAAGGAGAGGGAAGCTGG - Intronic
931169832 2:59790974-59790996 AAGGGAAAGGCGAGGGAGGCTGG + Intergenic
932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG + Intronic
932314879 2:70773386-70773408 GACGGAAAGGAGAGGGAGCAGGG + Intergenic
933764100 2:85695450-85695472 GAGGGAAAGGAGAGGGACTGTGG - Intronic
933920693 2:87042024-87042046 CAGGGAATGGAGACTGGTCCAGG + Intergenic
933930932 2:87151762-87151784 CAGGGAATGGAGACTGGTCCAGG - Intergenic
934002305 2:87727874-87727896 CAGGGAATGGAGACTGGTCCAGG - Intergenic
934080936 2:88467331-88467353 CTGGGAAAGCAGAGGGATAGGGG + Intergenic
935047224 2:99493222-99493244 CAGAGAAAGGAGAGAGAACAGGG + Intergenic
936362191 2:111813681-111813703 CAGGGAATGGAGACTGGTCCAGG + Intronic
936629504 2:114186519-114186541 CAGGAAAAGGAGAGAGAAGCAGG - Intergenic
937181018 2:119996526-119996548 CAAGGAAAGAAGAAGGAACCAGG + Intergenic
937298738 2:120825680-120825702 CAGGCAAAGGACAGGCATCTGGG - Intronic
937917827 2:127107521-127107543 CTGGAAAAGGAGGGGGCTCCGGG - Intergenic
937999379 2:127719980-127720002 CAAGGAATGCAGAGGCATCCTGG - Exonic
938134419 2:128742658-128742680 CAGGGATAGGACAGGGAGCCAGG + Intergenic
938207757 2:129438537-129438559 CTGGGGAGGGAGAGGGAGCCTGG - Intergenic
938710963 2:133976021-133976043 GGGGGAAGGGAGAGGAATCCTGG - Intergenic
939110744 2:138003848-138003870 CAGAGAAAAGAATGGGATCCAGG - Intronic
939501840 2:142996537-142996559 CAGTGAAAGAAGAGGGATGTTGG + Intronic
939627721 2:144498554-144498576 TGGTGAAAGGAGAGGGATCATGG + Intronic
939984621 2:148817138-148817160 GTGGGAAAGGAGAGAGAGCCAGG - Intergenic
940011641 2:149060796-149060818 CAGGGAGAGGTGAAGGATCAGGG + Intronic
940180676 2:150929092-150929114 CAGTGAGAGGACAGGGATCCTGG - Intergenic
940405133 2:153292700-153292722 CAGGGAAAAGAGATGGAACCAGG + Intergenic
940745066 2:157558106-157558128 AAGGAGAAGGAGAGGAATCCAGG + Intronic
941168031 2:162104346-162104368 CAGGGGAAAGAGAGGGCACCAGG + Intergenic
941664036 2:168226000-168226022 CAGGGAAAGAAGAGAGAAGCTGG + Intronic
942042719 2:172081539-172081561 AAGGGAAAGGAGGGTGCTCCGGG - Exonic
943441253 2:187931279-187931301 CAGGGAATGGAGACTGGTCCAGG - Intergenic
943583150 2:189708026-189708048 AATAGAAAGGAGAGGGACCCGGG + Intronic
944317707 2:198301030-198301052 CAGGACAAGGAGATGGTTCCTGG - Intronic
945868658 2:215203560-215203582 CAGGAAAAGGGCAGGGGTCCTGG - Intergenic
946227269 2:218270599-218270621 CGGGGTAAGGAGAGGGACCCCGG + Exonic
946309661 2:218876386-218876408 CGGGGGAAGGACAGGGGTCCTGG - Intergenic
946332474 2:219018185-219018207 CAGACTTAGGAGAGGGATCCAGG - Intronic
946386428 2:219387070-219387092 CATGGAAAGGAGAGGGACTCCGG + Exonic
946832042 2:223737045-223737067 TGGGGAAGGGAGATGGATCCTGG - Intergenic
947576242 2:231277163-231277185 CAGGGAAAAGAGTGTGATTCAGG - Intronic
947628017 2:231633273-231633295 GAGGGTAAGGAGAGGGTTCCAGG - Intergenic
947736204 2:232456724-232456746 CAAGCAGAGGAGAGGGATCAAGG + Intronic
947971926 2:234331995-234332017 AAATGAAAGGAGAGGGAACCCGG - Intergenic
948388943 2:237598340-237598362 GAAGGAGAGGAGAGGGAACCAGG - Intronic
948560801 2:238849582-238849604 CAGGGATGGGCGAGGGGTCCAGG + Intronic
948756338 2:240161645-240161667 CAAGCCAAGGAGAGGGACCCGGG - Intergenic
948830063 2:240594328-240594350 CTGGGAAAAGAGAGGGCTCCAGG + Intronic
1168841832 20:914691-914713 AAGGAAAGGGAGAGGGACCCAGG - Intronic
1169084057 20:2816129-2816151 CAGGAAAGGGACAGGGATCCAGG + Intergenic
1169421819 20:5466541-5466563 CAGGTAAAGCCCAGGGATCCTGG - Intergenic
1170716171 20:18832935-18832957 GAGAGAAAGGAGAGGGAGGCTGG + Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171953445 20:31441316-31441338 GAGGGAAAGGAGAGTCCTCCTGG + Intronic
1172195807 20:33090682-33090704 CAGGCAAAGGAGAGGGTCACAGG - Intronic
1172948559 20:38706891-38706913 CAGGGAAAGGTGAGGGAGAAGGG - Intergenic
1173165910 20:40687431-40687453 CGAGGAAAGGAGAGGGACTCTGG - Exonic
1173288099 20:41691025-41691047 CATGGAAAGGAGAGATACCCAGG - Intergenic
1174078679 20:47956024-47956046 CAGGGAAAGCACAGGGTTCTAGG + Intergenic
1174462464 20:50692225-50692247 CAGGTCAAGGGGTGGGATCCAGG + Intergenic
1174488348 20:50875029-50875051 CAGAAGAAGGAGAGGGCTCCCGG - Intronic
1174615047 20:51829018-51829040 CAGGGAAAAGCCAGGGAGCCAGG - Intergenic
1175294348 20:57898019-57898041 CAGGTAAGGGAGATGGAGCCTGG - Intergenic
1175490803 20:59380072-59380094 CAGGGACAGGGGAGGGATCAGGG + Intergenic
1175624793 20:60481379-60481401 CAGGGAATGCAGAGGGACCCTGG - Intergenic
1175683338 20:61007490-61007512 CAGGGAACTGGGAGGGATCAAGG - Intergenic
1175841073 20:62027887-62027909 CAGGGAACTGAGAGGGGTCAAGG - Intronic
1176281938 20:64318252-64318274 CAGAGAAAGGAAAAGGAACCGGG + Intergenic
1176511828 21:7754592-7754614 CAGTGAAAGGAGCTGGAGCCCGG - Intronic
1176555509 21:8252654-8252676 CAGGGGGAGGAGACGGTTCCGGG + Intergenic
1176983805 21:15412802-15412824 CAGAGAAAGGAGAAAGCTCCAGG + Intergenic
1178293475 21:31388678-31388700 CAGAGAAAGTGGAGGGAGCCAGG + Intronic
1178461805 21:32809130-32809152 CTGGGAAAGGAGAGGCATCACGG + Intronic
1178645941 21:34385118-34385140 CAGTGAAAGGAGCTGGAGCCCGG - Intronic
1179033631 21:37741559-37741581 GAAGGAAAGGAGAGGAACCCAGG - Intronic
1179275212 21:39885692-39885714 CAGGGGAGGGAGAGGGTGCCTGG - Intronic
1179370741 21:40804166-40804188 CAGGGATAGGGGAGGCTTCCTGG + Intronic
1179498408 21:41790586-41790608 TAGGGAATGGGGAGGGATCAGGG + Intergenic
1179498487 21:41790769-41790791 TAGGGAATGGGGAGGGATCAGGG + Intergenic
1179520684 21:41942473-41942495 CTGGGAAAGGACAGGAACCCGGG + Intronic
1180560789 22:16612823-16612845 GAGGGAAAGGAGGAGGATCTGGG - Intergenic
1181085617 22:20438075-20438097 GAGGGAAAGGCGCGGGAACCGGG - Intronic
1181359276 22:22322565-22322587 CAGGGTCAGGGGAGGGGTCCAGG + Intergenic
1181362969 22:22352944-22352966 CAGGAGAAGGAGAGGAGTCCAGG - Intergenic
1181369377 22:22404317-22404339 CAGGGTCAGGGGAGGGGTCCAGG + Intergenic
1181539413 22:23565512-23565534 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1182522875 22:30894030-30894052 CAGGCAAAGGAGAGGGAAGGAGG + Intronic
1182751423 22:32644854-32644876 CCGGGAAAGGGGAGGGATGGGGG + Intronic
1183025974 22:35066224-35066246 CAAGGAAGGGAGAGGTACCCTGG + Exonic
1183363980 22:37397543-37397565 CAGGGAAAGGAGGGGGAACGTGG + Intronic
1183456197 22:37924633-37924655 ATGGGAAAGGAGAGTGAGCCAGG - Intronic
1183467469 22:37986892-37986914 CTTGGAGAGGGGAGGGATCCTGG + Intronic
1183499801 22:38171993-38172015 CAGAGCAAGGAGAGAGAACCTGG - Intronic
1183525079 22:38317769-38317791 CCTGGAGAGGAGAGAGATCCTGG - Intronic
1184392777 22:44214505-44214527 CGGGTAAAGGAGAGGGATCATGG - Intronic
1184472944 22:44706093-44706115 AAGAGAAAGGGGAGGGAGCCTGG - Intronic
1184486609 22:44783568-44783590 CAGGGAAAGGAGAGAGACCTAGG - Intronic
1184559756 22:45255387-45255409 CAGGGAGGGGAGAGGGCTCAGGG - Intergenic
1184806647 22:46798879-46798901 CAGGGCAGGGAGAGGGTTTCCGG + Intronic
1184982752 22:48105825-48105847 CAGGGAGAGCAGAGGGATGTGGG - Intergenic
1185195728 22:49468141-49468163 CAGAGAGAGGAGAGGAACCCTGG + Intronic
1185331420 22:50253661-50253683 CAGGGAAAGGGGAGGTGGCCAGG + Intronic
949247461 3:1942215-1942237 CAGGGAAAGAAAAGGGAACCCGG - Intergenic
950187185 3:10952390-10952412 CAGAGGAAGGAGGGGGGTCCAGG + Intergenic
950410939 3:12836504-12836526 CAAGCAATGGACAGGGATCCGGG + Intronic
950424832 3:12919463-12919485 CAGGGGAAGGGGAGGGCACCTGG + Intronic
950479104 3:13233767-13233789 CAGGGAAGAGTGAGGGCTCCCGG + Intergenic
950707640 3:14792890-14792912 CAGGGAGAGCACAGGCATCCAGG - Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
951752953 3:26057412-26057434 CTGGGACAGGAGAGGGAGCCAGG - Intergenic
951908036 3:27722535-27722557 AAGGAAAAGGAGAGGGCTTCTGG - Intronic
952722372 3:36546575-36546597 ACAGGAAAGGAGTGGGATCCTGG - Exonic
952889606 3:38031233-38031255 AAGGGAAAGGAGAGGCTCCCAGG - Intergenic
953056034 3:39387878-39387900 CAGGGACAGGAACGGGGTCCTGG + Intronic
953089786 3:39713317-39713339 GAGAGACAGGAGAGGGAACCGGG + Intergenic
953559301 3:43972174-43972196 CAGTGAGAGGGGAGGGCTCCTGG - Intergenic
954300524 3:49698619-49698641 CAGGGAAGGGTCAGGGACCCAGG + Intronic
955028752 3:55196163-55196185 CAGGCAAAAAAGAGGGAACCAGG - Intergenic
955213153 3:56960880-56960902 GAGGGAAGGGAGTGGTATCCAGG - Intronic
956529465 3:70201764-70201786 GAGGGAATGGAGAGGGAAGCAGG - Intergenic
957528610 3:81410891-81410913 AAAGGAAAGGAGAGAGATCGAGG + Intergenic
958537248 3:95419011-95419033 CAGAGAGAGGACAGGGACCCTGG - Intergenic
960630413 3:119725153-119725175 CAGGTAAAGGAAAGGGAGGCTGG - Intronic
960963545 3:123089346-123089368 CAGGGGAAGGAGTGGGAGGCAGG + Intronic
961484403 3:127207025-127207047 CAGGGCATCGAGAGGGAGCCAGG - Intergenic
962381474 3:134901637-134901659 CAGGGCAAGAAGAGTCATCCAGG + Intronic
963277504 3:143347547-143347569 CAGGGTAAGGAAAGGGCACCCGG + Intronic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
963642986 3:147881196-147881218 CAGGGAATGGAGACTCATCCAGG - Intergenic
963905928 3:150773679-150773701 CAGGGAAAGGGAAGTGACCCAGG + Intergenic
963978254 3:151507151-151507173 CAGGGAAAGCAGAGGAATAAAGG - Intergenic
964861705 3:161209662-161209684 CAGGGAAAAGGTAGGGATCAAGG + Intronic
964931297 3:162027843-162027865 CAGGGAAAGGTGAAGGTTGCAGG + Intergenic
965084505 3:164077476-164077498 CAGGGAAAGCAGAGGGAAAAAGG + Intergenic
967375087 3:188792218-188792240 CAGGGAAAGGAGAGAACACCTGG + Intronic
967427192 3:189340714-189340736 CAGGGAAAGCCAAGGGCTCCAGG - Intergenic
968557095 4:1251016-1251038 CTGAGAACGGAGAGGGATGCAGG + Intergenic
969398321 4:6937714-6937736 CAGGGAAGGGAGAGAGAGGCAGG + Intronic
971588318 4:28433201-28433223 CAGGGAAATGACAGGGAACATGG - Intergenic
973613884 4:52659960-52659982 CCGGGAAGGGGGAGGAATCCGGG + Intergenic
974006604 4:56563510-56563532 GAGGGGAAGGAGATGGATACAGG + Intronic
975434567 4:74335985-74336007 CATGGAAAGAAGAGTAATCCAGG + Intergenic
975672774 4:76798427-76798449 GAGAGAAAGGAGAGGGCTCCAGG + Intergenic
977257718 4:94758503-94758525 CCGGGAAATGGGAGGGAGCCCGG + Intronic
977590347 4:98819297-98819319 CAGTTAAAGGAAAGGGCTCCTGG + Intergenic
977701203 4:100024958-100024980 CATGTAAAGGAGAGAGATCATGG - Intergenic
978621386 4:110637285-110637307 GAGCGAAAGGAGAGGGGACCTGG + Intronic
979549603 4:121976232-121976254 AAGGGCATGGAGAGGGATTCTGG - Intergenic
980893470 4:138838786-138838808 CAGGGTAAGGAGAGGGGCGCGGG - Intergenic
982134390 4:152259437-152259459 CAGAGGAAGGAGAGGGGTGCAGG - Intergenic
982241757 4:153306837-153306859 CAGGGCAAGGACTGGGAGCCTGG - Intronic
984401495 4:179271421-179271443 AAGGGAAAAGAGAGGGAGGCAGG - Intergenic
984770087 4:183429779-183429801 GAGGGAAAGGAGCAGAATCCTGG + Intergenic
986339526 5:6777305-6777327 CAGAGAAAGCAGAGGGATGAAGG - Intergenic
987776315 5:22372305-22372327 AAAGCAAAGGAGAGGGAACCAGG + Intronic
989781456 5:45269907-45269929 AAGGGAAAGTAGAGGGAACATGG - Intronic
989981251 5:50648392-50648414 CAGGGAAAGGAAAAGGATTTGGG + Intergenic
990291745 5:54359352-54359374 CAGGGGAAGAAGAGGGGTCTAGG - Intergenic
990863734 5:60357107-60357129 AAGGGCAAGGAGAGGGTACCAGG + Intronic
991720721 5:69492747-69492769 GAGGGAAAGGAGAGGGAGAAGGG + Intronic
992923586 5:81555523-81555545 CAGGCAAAGATGAGGCATCCTGG - Intronic
993697423 5:91078346-91078368 GAGGGAAAGGAAAGAGCTCCTGG + Intronic
993867177 5:93209570-93209592 TAGGGAATGGCGAGGCATCCAGG + Intergenic
993896332 5:93539585-93539607 CAGAGACTGGAGAGGGATCAGGG + Intergenic
993984396 5:94580463-94580485 CAAGGAAAAGGGAGGGATCTGGG + Intronic
994134958 5:96275551-96275573 CAGGGAAAGGAGGTGGAGACAGG - Intergenic
994153126 5:96473039-96473061 AAGAGAAAGGAGAGGGAAACTGG - Intergenic
994457128 5:100025146-100025168 CAGAGACAGAAGGGGGATCCAGG + Intergenic
994501001 5:100577966-100577988 TAGAGAAAGAAGAGGTATCCAGG + Intronic
994779113 5:104068687-104068709 GAGGGAAAGGAGGAGGATCTGGG + Intergenic
994981719 5:106883489-106883511 AAAGGAAAGGAGAGAGATCATGG + Intergenic
997015699 5:129931922-129931944 AAGGGAAAGGAGAAGGATCTTGG + Intronic
997444888 5:133933723-133933745 CAGGGAAAGAAGAGGAATGAAGG - Intergenic
998406820 5:141878723-141878745 TAGGGTAAGGAGGGGAATCCAGG - Intronic
998567179 5:143226048-143226070 CTGGGAAAGCTCAGGGATCCTGG - Exonic
999684426 5:154089484-154089506 CAGGGCTAGCAGAGGGATCCAGG - Intronic
1000413297 5:160956756-160956778 AAGGGAAAGGAGAGTTTTCCAGG + Intergenic
1000556481 5:162732558-162732580 CAGATAAAGGAGAGGGCCCCTGG - Intergenic
1001334534 5:170786231-170786253 CAGGGAAAGGACAGGGATTGGGG + Intronic
1001422186 5:171596414-171596436 CAGGGATGGGGGAGGCATCCAGG + Intergenic
1001437903 5:171714917-171714939 GAGGAAAAGGGGAGGGATGCTGG - Intergenic
1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG + Intergenic
1001927939 5:175652668-175652690 CCGGGGGTGGAGAGGGATCCAGG - Intergenic
1002190292 5:177474049-177474071 CAGGGAAAGGAGACGGGCCAGGG - Intronic
1002199214 5:177517621-177517643 CCGGGAGAGGAGAGGCGTCCTGG + Intergenic
1002199308 5:177518344-177518366 CCGGGAGAGGAGAGGCGTCCTGG + Intergenic
1002214951 5:177624544-177624566 CAGGGGAGGGAGAGGGATGTTGG + Intergenic
1002909881 6:1481686-1481708 CAGGGAATGCAGAGGGAGGCTGG - Intergenic
1003065990 6:2903658-2903680 GCGGGAAAGGAGACGGAGCCTGG + Intergenic
1003086194 6:3063570-3063592 GCGGGAAAGGAGACGGAGCCTGG - Intergenic
1003119011 6:3304883-3304905 CAGGGAGAGGAGAGGGATGCAGG + Intronic
1003158514 6:3616657-3616679 CAGGCACAGGAAAAGGATCCAGG + Intergenic
1004121069 6:12822575-12822597 CAGGGAAGGGAGAGGAGGCCTGG - Intronic
1004307345 6:14512849-14512871 CATGGAAAGAAGAGGGAGCGAGG + Intergenic
1004920239 6:20369329-20369351 CAGGAAAAGGAGAAGGATCAGGG + Intergenic
1005016259 6:21377981-21378003 CAGGGGAAGGAGAGGGATGAGGG + Intergenic
1005068861 6:21845736-21845758 CAGGGGAAGGTGAGGGATGTGGG + Intergenic
1005871194 6:29975344-29975366 CAGGGAGAGGACAGGGCTTCAGG + Intergenic
1005993746 6:30919732-30919754 AAGGGAAGGGAGAGGGATCAAGG - Intronic
1006303684 6:33207166-33207188 CAGAGAAAGGAGAGGGGTGGGGG - Intergenic
1007102678 6:39260935-39260957 CAGGGAATGGAGGGGGCTTCAGG - Intergenic
1007346890 6:41237448-41237470 AGGGGAAATGTGAGGGATCCTGG - Exonic
1008847140 6:55981378-55981400 CATGGGAAGGAGAGTAATCCTGG - Intergenic
1010277068 6:73981107-73981129 CAGGGTAGGGAGAGGGAGCTGGG - Intergenic
1010625836 6:78135367-78135389 CAGGGAAAGGAAAGGGAAAAGGG + Intergenic
1011292990 6:85795798-85795820 GAGGGAATGGAGAGGGAAGCAGG + Intergenic
1013691865 6:112654515-112654537 CAGGAAGACGAGAAGGATCCAGG + Intergenic
1015190308 6:130465015-130465037 GAGAGAAAGGAGAAGGTTCCAGG + Intergenic
1017027208 6:150191925-150191947 TAGGGAAAGAAGAGGGTTCCAGG + Intronic
1018990087 6:168668066-168668088 GAGGGAAAGGTGAGGGCTCTGGG + Intronic
1019151732 6:170010953-170010975 AAGGGAAAGGAGAGGGAATAAGG + Intergenic
1019608083 7:1920113-1920135 CTGGGGAAGGACAGGGATGCTGG - Intronic
1020105923 7:5422286-5422308 GAGGGGAAGGAAAGGGATCAAGG + Intronic
1020250934 7:6467865-6467887 CAGGGAAAGAAGAGGCACTCAGG + Intronic
1020803172 7:12756842-12756864 CTGGGAAAGGAGAAGGAAACTGG + Intergenic
1022105364 7:27192779-27192801 GAGGGAACGGAGAGCGAGCCGGG - Intergenic
1023183039 7:37504868-37504890 TGGGGAAAGGAGAGGCACCCTGG + Intergenic
1023202277 7:37711732-37711754 CAGGGACAAGAGAGGGATACAGG - Intronic
1023735591 7:43233533-43233555 TGGGGGAAGGAGAGGCATCCAGG - Intronic
1023849286 7:44141177-44141199 CAGGGAGAGGAAGAGGATCCTGG - Intronic
1023882282 7:44327106-44327128 CTGAGGAAGCAGAGGGATCCTGG + Intronic
1024393660 7:48842861-48842883 CTGGGAAAAGGGAGGGCTCCAGG + Intergenic
1025002223 7:55325971-55325993 AAGTGAGAGGAGAGGGATCTGGG - Intergenic
1025140217 7:56456813-56456835 CAGGGTTAGGAGAGTCATCCCGG + Intergenic
1025856604 7:65285827-65285849 AAGGGAAAGAAGAGGTAGCCTGG + Intergenic
1026230247 7:68476571-68476593 CTGGAAAAGGAGAGGGAGACTGG + Intergenic
1026396465 7:69959497-69959519 CAGGTGAAGGTGAGGGATACTGG - Intronic
1026822079 7:73556855-73556877 CAGGGAAATTAGAGGGAGGCTGG + Intronic
1026894885 7:74004253-74004275 CAGGGAAGGGGAAGGGCTCCAGG - Intergenic
1028380297 7:90192452-90192474 CAGGAAAAGGAGAAAAATCCCGG - Intronic
1028484326 7:91341573-91341595 GAAGGAAAGTAGAGGAATCCAGG + Intergenic
1029710411 7:102296115-102296137 CAGGGACAGAACAGGGCTCCCGG - Intronic
1030081525 7:105782670-105782692 CAGGGAACGCAGAGAGATACTGG + Intronic
1030373983 7:108733437-108733459 CATGGAGAGGAGAGAGATGCAGG - Intergenic
1030820656 7:114087323-114087345 CAGGGAAAGGAACGCGATCAAGG - Intronic
1031854986 7:126911665-126911687 CAGGGGAAGCAGAGAAATCCAGG + Intronic
1033153048 7:138933188-138933210 CAGGGAAGGGAGATGGTACCTGG + Intronic
1033750874 7:144360207-144360229 CTGAGGCAGGAGAGGGATCCTGG - Intronic
1034533265 7:151710564-151710586 CAGGGAGAGGGCAGGGCTCCCGG - Intronic
1034978892 7:155463364-155463386 GAGGGTGAGGAGAGGGAGCCGGG - Exonic
1035241276 7:157531261-157531283 CAGGGAAAGCAGAAGCTTCCCGG + Intergenic
1035265581 7:157688946-157688968 CAGAGCCAGGAGAGGGGTCCCGG + Intronic
1035389726 7:158496694-158496716 CAGGGAAGGGGGAGGGGTGCAGG - Intronic
1035723784 8:1812528-1812550 CAGGGAGCTGTGAGGGATCCTGG + Intergenic
1035772388 8:2158271-2158293 CAGGGAAAGGATGGGCGTCCAGG - Intronic
1036137535 8:6175612-6175634 CAGGAAAAGGAGAGGAACACGGG + Intergenic
1037533254 8:19800694-19800716 TAGAGAAAGGATTGGGATCCTGG - Intergenic
1037812455 8:22095144-22095166 AAGGGAAAAGTGAGGGATGCAGG - Intronic
1038491950 8:27977719-27977741 CAGGGCAGTGATAGGGATCCCGG - Intronic
1039455226 8:37701486-37701508 TAGCAAAAGGAAAGGGATCCTGG + Intergenic
1040285825 8:46099926-46099948 CTGGGAAGGGAGAGGCCTCCTGG - Intergenic
1040320027 8:46287732-46287754 CTGGGAAGGGAGAGGCCTCCTGG + Intergenic
1040323232 8:46328857-46328879 CTGGGAATGGAGAGGCATCCTGG + Intergenic
1041192964 8:55372050-55372072 CAGGGAGAGGAGCGGGGTCATGG + Intronic
1041309733 8:56503162-56503184 CAGGGAAAGGAGATGGGGTCTGG + Intergenic
1041357879 8:57021243-57021265 CGTGGAAAGGAGAGGGAGACGGG - Intergenic
1042426640 8:68656753-68656775 CCAGGAAGGCAGAGGGATCCAGG - Intronic
1042722692 8:71842531-71842553 CAGGGAAAGGGGAAGGGTCAAGG + Exonic
1044233429 8:89804800-89804822 CAGGGGAATGAGGTGGATCCGGG - Intergenic
1045650311 8:104336194-104336216 CAAGGAAGGGAGAGGGCTGCAGG + Intronic
1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG + Intronic
1046120458 8:109839952-109839974 TAGAGGAAGAAGAGGGATCCAGG - Intergenic
1046787464 8:118283640-118283662 CAGGGAAGGGAGATCCATCCTGG + Intronic
1047801921 8:128318923-128318945 CTGGGAAGGGAGAGGGAACCAGG + Intergenic
1048593729 8:135845111-135845133 CAGGGACAGGATAGGGAAGCTGG + Intergenic
1048933214 8:139333358-139333380 CAGGAAAAGGAAAGGAAACCAGG + Intergenic
1049208929 8:141376440-141376462 CAGGAAGAGGTGAGGGAGCCTGG + Intergenic
1049572618 8:143376351-143376373 CAGGGGCAGCAGTGGGATCCGGG - Intronic
1049600473 8:143505160-143505182 CAGGGATGGGAGAGGGAGCTGGG + Intronic
1049628284 8:143636425-143636447 GGGGGGAAGGAGAGGGAACCAGG - Intronic
1051857861 9:21589743-21589765 GAGGGAAAGGAGAGAGATAAGGG - Intergenic
1052352986 9:27476073-27476095 TAGGGGAAGGAGAGGTATCCAGG - Intronic
1052467176 9:28843606-28843628 CAGAGAAAGGGGAGGGATGGAGG + Intergenic
1054873784 9:70074469-70074491 CTGGGACAGGTGAGGCATCCAGG - Intronic
1055549436 9:77417884-77417906 CAGGGAAAGGAGAGATTTCACGG - Exonic
1056487459 9:87073149-87073171 CAGGGAAGTGAGGGGGATCATGG + Intergenic
1056715763 9:89026877-89026899 CAGGGAAAGGAGGAGACTCCTGG + Intronic
1056779585 9:89539175-89539197 CAGAGCAAGGAGAGGCAGCCAGG - Intergenic
1057258428 9:93569225-93569247 CAGGGCAAGGAGGGGTGTCCTGG - Intergenic
1057286404 9:93758326-93758348 CAGGGAAGGGAGAGGGACTAAGG - Intergenic
1059046816 9:110878088-110878110 AAGATAAAGGAGAGGAATCCAGG - Intronic
1059228671 9:112697019-112697041 CGGGGAAAGGAGAGGGACTGAGG - Intronic
1059318858 9:113450597-113450619 CTGGGAATGGAGAGAGATCTAGG + Intronic
1059421139 9:114193153-114193175 CAGGGAGGGGAGAGGGCTCAAGG + Intronic
1059449183 9:114359650-114359672 CAGGGAAAGCAGAGGCCACCAGG - Exonic
1059534752 9:115070314-115070336 CTGGGAAAAGAGTGGTATCCAGG + Intronic
1059934788 9:119298815-119298837 AAGGGAAAGGAGAGGGTTGTGGG - Intronic
1060047822 9:120354419-120354441 CAGGAAATGGAGTGGGACCCAGG + Intergenic
1060211293 9:121712106-121712128 CAGGAAAAGCAGAGGAGTCCAGG - Intronic
1060251154 9:121987762-121987784 CAGGGGAGGGGGAGGGAGCCAGG - Intronic
1060662171 9:125410932-125410954 CAAGGCAAGGATGGGGATCCTGG - Intergenic
1061016064 9:127981213-127981235 GAGGGAAGGGAGAGGGGCCCTGG + Intergenic
1061216098 9:129222878-129222900 CGGGGAAGGGAGGGGGAGCCGGG - Intergenic
1061271646 9:129547122-129547144 CAGGGAAAGTGGAGGGGTCCTGG - Intergenic
1061275555 9:129568018-129568040 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1061275742 9:129568750-129568772 CTGGGAAAGGAGAGGGCAGCGGG + Intergenic
1061621680 9:131814757-131814779 CAGGGAGGGGAGAGGAAGCCCGG - Intergenic
1061716501 9:132521608-132521630 CAGGCGAAGGAGAGGAGTCCAGG + Intronic
1061719885 9:132545002-132545024 CAGAGCAAGGAAAGGGCTCCAGG + Intronic
1061750512 9:132773801-132773823 CAGGGCAAGAAGAGGCATCAGGG + Intronic
1061835683 9:133328050-133328072 CAGGGAAAGGATCGGGGTGCAGG - Intergenic
1061926979 9:133810752-133810774 CAGGGACAGCAGCGGGCTCCAGG + Intronic
1061995457 9:134180729-134180751 CTGGGGAAGAAGATGGATCCTGG - Intergenic
1062126149 9:134864122-134864144 CAGGGGAGGGAGAGGGAAGCAGG - Intergenic
1062209777 9:135357213-135357235 CAGAGAAAGCCAAGGGATCCAGG + Intergenic
1062376629 9:136264653-136264675 CAGGGCAGGGATGGGGATCCCGG + Intergenic
1062585523 9:137247753-137247775 CAGGGAAGGGAGCTGGATGCCGG - Exonic
1186140269 X:6564464-6564486 AAAGGAAAAGAGAGGGATCCAGG + Intergenic
1186386297 X:9113611-9113633 AAGCGAATGGAGAGGGAGCCTGG - Intronic
1187262227 X:17696323-17696345 TAGGGAGAGGAAAGGGTTCCCGG + Intronic
1187680550 X:21763294-21763316 CTGGGAAAGAAGAGGGAGCAAGG + Intergenic
1187696680 X:21929520-21929542 CAGGGGAAGGAGTAGGAGCCAGG + Intergenic
1188896314 X:35672799-35672821 TAGGGAAGGGAGAGGTATGCTGG - Intergenic
1189686668 X:43571537-43571559 AATGAAAAGGAGAGGGATGCTGG - Intergenic
1190177027 X:48158762-48158784 GAGGGAAACGAGCAGGATCCAGG - Intergenic
1192106808 X:68325781-68325803 CGGGAAAAGGAGAAGGATACCGG - Intronic
1193376021 X:80762573-80762595 TGGGGAAAGGAGAGGGATAAAGG + Intronic
1195301797 X:103536979-103537001 CAGGGAAGGGAGAGGGATTGAGG + Intergenic
1195327844 X:103772468-103772490 CAGGGGAAGTATAGGAATCCTGG + Intergenic
1195667937 X:107447747-107447769 CAGGGACTGGAGAGGGAGCCAGG - Intergenic
1195681459 X:107550015-107550037 CAGGGAAAGGACAAGGAGACCGG - Intronic
1198438358 X:136638542-136638564 CAGGGGAGAGAGAGGGCTCCAGG + Intergenic
1198562697 X:137867944-137867966 CAGGGAAAGGAGAGGGGCAGAGG + Intergenic
1199234524 X:145475518-145475540 CAGGGAAAGAAGAGGAATAAAGG + Intergenic
1199819148 X:151427417-151427439 CAGGTGAAGGAGAGGAGTCCAGG + Intergenic
1200194752 X:154240186-154240208 CAGGGAAAGAAGAGGAAGGCAGG + Intergenic
1200948138 Y:8866240-8866262 CAAGAAAAGGAAAGGGAACCAGG + Intergenic
1202038623 Y:20660298-20660320 CAGGGAAAGGAAAGGGGACAAGG + Intergenic