ID: 1125591651

View in Genome Browser
Species Human (GRCh38)
Location 15:40857950-40857972
Sequence AATTCTGCTCATTTGGAGGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 186}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125591647_1125591651 2 Left 1125591647 15:40857925-40857947 CCTGTTGAGTGGTTGAGCTCTCC 0: 1
1: 0
2: 1
3: 4
4: 59
Right 1125591651 15:40857950-40857972 AATTCTGCTCATTTGGAGGTTGG 0: 1
1: 0
2: 2
3: 16
4: 186
1125591646_1125591651 9 Left 1125591646 15:40857918-40857940 CCACAAGCCTGTTGAGTGGTTGA 0: 1
1: 0
2: 0
3: 4
4: 88
Right 1125591651 15:40857950-40857972 AATTCTGCTCATTTGGAGGTTGG 0: 1
1: 0
2: 2
3: 16
4: 186
1125591643_1125591651 25 Left 1125591643 15:40857902-40857924 CCTGGTGTGAGCCTCTCCACAAG 0: 1
1: 0
2: 0
3: 12
4: 211
Right 1125591651 15:40857950-40857972 AATTCTGCTCATTTGGAGGTTGG 0: 1
1: 0
2: 2
3: 16
4: 186
1125591644_1125591651 14 Left 1125591644 15:40857913-40857935 CCTCTCCACAAGCCTGTTGAGTG 0: 1
1: 0
2: 0
3: 9
4: 162
Right 1125591651 15:40857950-40857972 AATTCTGCTCATTTGGAGGTTGG 0: 1
1: 0
2: 2
3: 16
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125591651 Original CRISPR AATTCTGCTCATTTGGAGGT TGG Exonic
903287384 1:22285598-22285620 ATTTCTGTGCATTTGGAGGTGGG + Intergenic
903814899 1:26057780-26057802 GATTCTGCTCAGTTTGGGGTGGG - Intronic
904463324 1:30693242-30693264 CAGGCTGCTCACTTGGAGGTGGG - Intergenic
906030093 1:42712164-42712186 GCTTCTGCTCATTTGGGGTTTGG + Intergenic
907122538 1:52019986-52020008 CATTGTGCTCATTTGAATGTGGG + Intergenic
907497561 1:54854951-54854973 AAGTCTTCTCTGTTGGAGGTGGG - Intronic
908425574 1:64003919-64003941 ACTTGTGATCATTTGGAGGGTGG - Intronic
908903971 1:68986505-68986527 TATTCTGTTGATTTGGGGGTGGG - Intergenic
909303966 1:74048332-74048354 AATTCTTCTAATTTGGAGAGGGG + Intronic
910481359 1:87661964-87661986 AATTATGCCCATTTGCAGATGGG + Intergenic
912749061 1:112270431-112270453 AATCCAGATCATTTGGTGGTTGG + Intergenic
913275913 1:117137602-117137624 AATTCTCCTCCTTTGAAGATTGG + Intergenic
914866835 1:151437453-151437475 AATTATTCTCATTTGCTGGTGGG + Intronic
918284544 1:183039211-183039233 AATTGTGTTCTTTTGGAGGTGGG + Intronic
918889820 1:190252614-190252636 AATTCTGCTCATGCTGAGTTAGG + Intronic
923556522 1:235004998-235005020 AATTCTGCTCATGTGGTTCTAGG + Intergenic
1063176291 10:3553663-3553685 AATTTAGTTCATTTGGAAGTAGG + Intergenic
1063594074 10:7417428-7417450 AATTCAGCTTATTTGTAGCTAGG - Intergenic
1064536513 10:16362853-16362875 ACTTCTGCTCATTTGAACATTGG - Intergenic
1066138460 10:32476670-32476692 AATTCTCCTCAATTGCAGGGGGG - Intronic
1068523155 10:58099782-58099804 AATTCTGCCCAGTAGAAGGTGGG + Intergenic
1069083259 10:64111014-64111036 AATTCTGTTAATTTGGAAGTAGG - Intergenic
1070211442 10:74327060-74327082 TTTTCTGCTAATTTGGAGTTTGG + Intronic
1071262972 10:83937881-83937903 AGGTCTGCCCATTTGGAGGGGGG - Intergenic
1074238672 10:111613011-111613033 ATTTGTGGTCATTTGGAGCTGGG + Intergenic
1074848914 10:117422810-117422832 AATTCGAACCATTTGGAGGTAGG + Intergenic
1080825245 11:35843003-35843025 AATTCTGTTCATTTTTCGGTAGG - Intergenic
1081854240 11:46294155-46294177 ATTTCTGCTTATTTGGACTTGGG + Intronic
1081907096 11:46677061-46677083 AAAACTGCTCATCTGGATGTTGG - Exonic
1084168722 11:67390016-67390038 AATTCAACTCATTTGAAAGTGGG + Intronic
1087333195 11:96810226-96810248 ACTTCTGCTAATTTGGGGTTTGG + Intergenic
1088374465 11:109124849-109124871 AATTCTGCTCAGTCTCAGGTAGG - Intergenic
1088698765 11:112392850-112392872 AAGTCTTCACATTTGGAGGAGGG + Intergenic
1090901606 11:131037302-131037324 AATTCTGATCATTTGGAATCAGG - Intergenic
1091133643 11:133168096-133168118 AATTCTTCTCCTTGGGAGATGGG - Intronic
1093387009 12:18569321-18569343 AACTGTGATCATTTGGTGGTTGG - Intronic
1094310701 12:29077850-29077872 AATACTGCTTATATGGAAGTTGG + Intergenic
1095712241 12:45302755-45302777 CATTAGGCTCATTTGGAGGGCGG + Intronic
1097357355 12:58616577-58616599 AATTCTGTGCACTTTGAGGTTGG - Intronic
1098566518 12:71943370-71943392 ATGTCTGCTTATTTGTAGGTGGG + Intronic
1098892327 12:76022242-76022264 TAGTCTGCTCATTTGTAAGTGGG - Intergenic
1101062993 12:100990718-100990740 AATTCTCCAGATTTGGAGGGAGG + Intronic
1103250282 12:119494167-119494189 AAGTCTACTCATTTCTAGGTAGG - Intronic
1103440513 12:120959412-120959434 TATCCAGCTCATCTGGAGGTTGG - Intergenic
1106585052 13:31049839-31049861 AATTCGGCTAATTTGTTGGTAGG - Intergenic
1107363675 13:39647048-39647070 AATTCTGCTCAAGGAGAGGTAGG + Intergenic
1107582939 13:41811578-41811600 AATTGTGCTAAGTTGGAGATGGG + Intronic
1107662607 13:42654846-42654868 AATTCTACTCCTTTGAAGGAGGG - Intergenic
1108905766 13:55469993-55470015 AATACAGCTAATTTGGAGATTGG - Intergenic
1110584272 13:77170142-77170164 TATTCCTCTCATTTGGATGTTGG + Intronic
1111601344 13:90479453-90479475 AATTCTGCTAATTTGCAAGAAGG + Intergenic
1113191925 13:107758912-107758934 AAGTCTTATCATTTGGAGGTAGG - Intronic
1117440906 14:55758279-55758301 AATTCTGCTCAGAAGGGGGTGGG + Intergenic
1121034139 14:90685289-90685311 AGTTATGCTGGTTTGGAGGTGGG - Intronic
1122145877 14:99688576-99688598 AAAAGTGCTGATTTGGAGGTGGG - Intronic
1124101843 15:26703114-26703136 AATGATGCTTATTAGGAGGTGGG - Intronic
1124936160 15:34173145-34173167 AATTCTTTTTATTTGGATGTTGG - Intronic
1125591651 15:40857950-40857972 AATTCTGCTCATTTGGAGGTTGG + Exonic
1125649336 15:41301439-41301461 AATTCAGCACATTTGGAAATAGG - Intergenic
1126508423 15:49436639-49436661 ACTTATGCTCATTTGCAGATGGG + Intronic
1129493621 15:75954758-75954780 TTTTCTGCTTCTTTGGAGGTTGG + Intronic
1133639122 16:7699885-7699907 AGAACTGGTCATTTGGAGGTGGG + Intronic
1136596821 16:31256444-31256466 AATTCCTCCCATTGGGAGGTGGG + Intergenic
1140269215 16:73448047-73448069 AAATCAGCACATTTGGATGTTGG + Intergenic
1141187101 16:81795869-81795891 AATTCTGTTCAATAGAAGGTGGG - Intronic
1143487759 17:7263858-7263880 AATCCTGCACTTTAGGAGGTGGG - Intronic
1143775550 17:9196461-9196483 AATCCTGCTCAGCAGGAGGTGGG - Intronic
1144621430 17:16821046-16821068 TATTCTCCTCACTTGGAGGTGGG - Intergenic
1145040600 17:19575292-19575314 ACTTATGCTCATTAGGAAGTGGG + Intronic
1146356199 17:32136363-32136385 CATTCAGGCCATTTGGAGGTAGG + Intergenic
1147573408 17:41585360-41585382 TATTCTCCTCACCTGGAGGTGGG - Intronic
1149282737 17:55126261-55126283 ACATCTGGTCTTTTGGAGGTTGG - Intronic
1149931267 17:60758419-60758441 TATTCTGCTAATTTTGAGTTTGG + Intronic
1155853086 18:30796806-30796828 AAATCAGCACATTTGGAGGTAGG + Intergenic
1157374003 18:47146339-47146361 AATTTTGCCCATCTGTAGGTTGG - Intronic
1158476957 18:57788721-57788743 AAATCTCCTCATTTGGGAGTTGG - Intronic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
1168431297 19:56283053-56283075 AATTCTGCTCCTTCCTAGGTGGG + Intronic
926875724 2:17476148-17476170 AATTCAGCACATTCTGAGGTAGG + Intergenic
929202408 2:39250804-39250826 AATGCTGCTCATTTGATCGTGGG + Intronic
929497286 2:42457159-42457181 TAGTCTCCTCATTTGTAGGTGGG - Intronic
929760694 2:44803524-44803546 TATTCTGTTCTTTTGGGGGTGGG - Intergenic
929990033 2:46779243-46779265 AATTTTGCCCATTTTGAGATGGG + Intergenic
930837059 2:55805606-55805628 AACTCTTCAGATTTGGAGGTGGG - Intergenic
931384630 2:61787033-61787055 AATTCTGCTCCTTGGAATGTGGG + Intergenic
931740168 2:65235333-65235355 AATTCTGTTCATTTTAAGGGTGG + Intronic
933054070 2:77639742-77639764 AATTCTACTAATTTGGGGTTTGG + Intergenic
933639678 2:84746143-84746165 AAGTCAGCTCATATGGAAGTAGG + Intronic
934092623 2:88566169-88566191 AATTCTGCTCAATAGAAGGCAGG - Intronic
934649121 2:96078993-96079015 AAATCTGTTTATTTGAAGGTAGG - Intergenic
936545305 2:113387197-113387219 AATTCTCCGGATTTGGAGGTGGG + Intergenic
936701055 2:115012104-115012126 CATTCAGCTCATGTGGAGGACGG - Intronic
937020979 2:118654921-118654943 AATTCTGTTCATTTTAAGTTGGG - Intergenic
937306599 2:120875394-120875416 AGTGCTGCTCACTTGGAGGAGGG + Intronic
939813573 2:146866471-146866493 AATGTTGCTAATTTGCAGGTGGG - Intergenic
940798734 2:158108956-158108978 AGTTCTGAACATTTGGAGCTAGG - Intronic
942682643 2:178494224-178494246 CAGTCTGATAATTTGGAGGTTGG + Intronic
942771342 2:179524726-179524748 AACTCTACTCAATTGGAGGCTGG + Intronic
943757986 2:191577707-191577729 AATTCTGTTCAGGTGAAGGTTGG + Intergenic
945923444 2:215779580-215779602 AATATTGCTCATTTGAGGGTAGG - Intergenic
946345366 2:219105776-219105798 AATTCTGGCCATTTGAAGGAGGG - Intronic
946938221 2:224743853-224743875 AATTCTACTCATTTGGAGCTGGG - Intergenic
947940612 2:234051710-234051732 CATGGGGCTCATTTGGAGGTAGG + Intronic
948351165 2:237342290-237342312 ATATCTTCTCATTTGGGGGTGGG + Intronic
1175364753 20:58445077-58445099 GAGTCTGGTCATGTGGAGGTGGG + Exonic
1175635218 20:60576728-60576750 AATTCTGCTTATTTGCCGTTAGG + Intergenic
1177063884 21:16405294-16405316 ACTGCTGCACATTTGGGGGTGGG - Intergenic
1177221450 21:18198571-18198593 AATTCTGCTCTTTGGGAGTTTGG - Intronic
1177571339 21:22890745-22890767 AATTCTTCTAGTTTGCAGGTGGG + Intergenic
1177947867 21:27494942-27494964 AATTCTGAGCATTTGCAGGTGGG + Intergenic
1179374608 21:40838863-40838885 AATACTGCTGATTTACAGGTTGG - Intronic
1181942248 22:26487325-26487347 AAGTCTTCTCATGTAGAGGTAGG - Intronic
1182110842 22:27722160-27722182 AATTCTGCTGATCTGCAGTTGGG + Intergenic
1183052321 22:35273438-35273460 ACTTCTGCTCATTTGTAAATTGG + Intronic
949971379 3:9408273-9408295 AAAACTGCTCATTTGGAAATGGG - Intronic
950457289 3:13100245-13100267 AATTCTTCTGTTTTGGAGGGAGG - Intergenic
951234408 3:20217850-20217872 TTTACTGCTCGTTTGGAGGTGGG + Intergenic
951663089 3:25092409-25092431 TATTCTGCTAATTTGTAAGTAGG + Intergenic
952623641 3:35377029-35377051 AATTCTACCAAATTGGAGGTTGG - Intergenic
952742846 3:36750966-36750988 AATTTTGCCCAGTTGGATGTTGG - Intergenic
952939993 3:38436042-38436064 TTTTCTGCTAATTTGGAGTTTGG - Intergenic
956958653 3:74372207-74372229 CATTTTGCTAATTTGGAGGAGGG - Intronic
959322603 3:104897154-104897176 TATTCTGCTTATCTGAAGGTAGG + Intergenic
960625520 3:119677972-119677994 AATTCAGATCAGTTGGAGGGGGG - Intergenic
964562687 3:158015336-158015358 AATTGTGCATGTTTGGAGGTGGG + Intergenic
967091000 3:186134770-186134792 AAATCAGCTAATTTGGGGGTGGG - Intronic
969882980 4:10190765-10190787 TCTTCTGCACATTTGGAAGTAGG - Intergenic
972725378 4:41742915-41742937 AGTTCTCCTCATTTGAAGGGAGG - Intergenic
976312692 4:83628023-83628045 AATTCTCCTCATTTGAAAATGGG - Intergenic
977554647 4:98476511-98476533 TCTTCTGCTCATTTCTAGGTGGG - Intronic
977712418 4:100142863-100142885 AATTCAGAGCATCTGGAGGTGGG - Intergenic
979682894 4:123481012-123481034 GAGTCTTCTCATTTGGAGTTGGG + Intergenic
980744715 4:136999561-136999583 GAATCTGCTCATTCTGAGGTTGG + Intergenic
980971425 4:139570868-139570890 AATTAGGCTAATTTGGAGGAAGG + Intronic
981066261 4:140489505-140489527 GATTCTGCTTATCTGGGGGTAGG - Intronic
981105903 4:140881044-140881066 AATTCTGCTAATTTTGAATTTGG + Intronic
983077043 4:163338654-163338676 GATTCTGGTAATTTGGGGGTTGG - Intronic
984600515 4:181721331-181721353 AAATTTGATCATGTGGAGGTAGG - Intergenic
984609990 4:181827084-181827106 AATTCTGCCCCTTGGAAGGTAGG - Intergenic
986549503 5:8936672-8936694 TAGTGTGGTCATTTGGAGGTAGG - Intergenic
987103671 5:14616028-14616050 AATTCTAATCCTTTGCAGGTTGG + Intergenic
987271721 5:16315948-16315970 CATTTTGCTCATTTGGAATTTGG - Intergenic
988916805 5:35902694-35902716 ATCTCTGCTCATATAGAGGTTGG - Intergenic
988985859 5:36618332-36618354 ACTTCTGCTAAATTGGTGGTAGG - Intronic
990018218 5:51092817-51092839 AATTCTTCTAATTTGGTGGAGGG + Intergenic
991027932 5:62051395-62051417 TAGTGTGGTCATTTGGAGGTAGG + Intergenic
992012800 5:72546396-72546418 CATTCTACTAATTTGGAGTTTGG + Intergenic
992309850 5:75485486-75485508 TATTCTGCTAATTTGGGGTTTGG - Intronic
993515369 5:88827062-88827084 GCTTCTGCTCATTTTGAGTTTGG + Intronic
995239038 5:109865018-109865040 CATTCTGCTCATTTGCAGGTGGG + Exonic
996287547 5:121812462-121812484 TTTTCTGTTCATTTGGACGTTGG + Intergenic
996581467 5:125036562-125036584 AATTCTGTTCATTAGGAAATAGG + Intergenic
997782042 5:136668367-136668389 TCTTCTGCTAATTTGGAGTTTGG - Intergenic
998486371 5:142506028-142506050 ATTTCTGATCATTTGGATTTGGG - Intergenic
998790680 5:145763498-145763520 CTTTCTGCTTATTTGCAGGTTGG - Intronic
1004027805 6:11836335-11836357 AATTCTCCTCTTCTGGAGGAAGG + Intergenic
1004110225 6:12710471-12710493 ATTTCTGCTCATTTACAGATAGG + Intergenic
1005240342 6:23818136-23818158 TATTCTGTTGATTTGGGGGTGGG - Intergenic
1006847686 6:37074201-37074223 AATTCTGCTGAAATGGAGGAGGG + Intergenic
1010138572 6:72585510-72585532 AATTTTGCTAATCTGGTGGTAGG + Intergenic
1013131631 6:107238734-107238756 CATTCTTATCATTTGGAGGATGG + Intronic
1014601945 6:123424022-123424044 TATTCTGCTCATTTGGTGAATGG - Intronic
1014837275 6:126173790-126173812 AATTCTGCTGGTTTCCAGGTTGG - Intergenic
1016434467 6:144021576-144021598 ACTTTTGCACATTTGTAGGTAGG - Intronic
1017038536 6:150288825-150288847 AATTCACCTCATTTGTAGGAGGG - Intergenic
1020208780 7:6142124-6142146 AATTCTGCTCATTTTTAAATGGG + Intronic
1022419559 7:30207606-30207628 ACTGCTGCTCATTTGGGAGTCGG + Intergenic
1023153416 7:37223812-37223834 TATTATTTTCATTTGGAGGTGGG - Intronic
1024724802 7:52180374-52180396 AAATCTGCTTCTTTGGATGTGGG + Intergenic
1024783470 7:52878956-52878978 TTTTCTGCTCATTTGGACTTAGG - Intergenic
1026336282 7:69396796-69396818 AATTCTGCTCAATTGCAGATGGG - Intergenic
1026942393 7:74294703-74294725 AATGCTGCACATTGTGAGGTGGG - Intronic
1028828883 7:95305344-95305366 AATTCTGGTCATCTGAAGGTTGG - Intronic
1029796712 7:102902828-102902850 ACTTCTGCTAATTTGAAGTTAGG + Intronic
1030409894 7:109163176-109163198 AACTCTGCGTATTTGAAGGTGGG + Intergenic
1033647553 7:143316900-143316922 ATCTCTGCTCATTTTGACGTTGG - Intronic
1033725136 7:144107930-144107952 GTTTCTTCCCATTTGGAGGTCGG - Intergenic
1034736821 7:153436901-153436923 AACTCTGGCCATTGGGAGGTTGG + Intergenic
1037606910 8:20445823-20445845 ATTTCTGCTTATTTGAAGATTGG - Intergenic
1037654693 8:20872841-20872863 AACTCTGGTCATTGGGAGGCCGG + Intergenic
1040574146 8:48636087-48636109 AATTCTGCTCTTTTTGAGGGTGG - Intergenic
1042523039 8:69734345-69734367 GAATCTGCCCATTTGGAGTTTGG - Intronic
1046097727 8:109580428-109580450 AATGCGGTTCATTTGGAGGATGG + Intronic
1046507267 8:115152089-115152111 AAACCTGCTCATTTGGATTTTGG + Intergenic
1048375576 8:133819618-133819640 AAATCTGCTCATCTGGAGTTGGG - Intergenic
1048691064 8:136963893-136963915 AATAATGGTCATTTTGAGGTTGG - Intergenic
1050002294 9:1090650-1090672 AATGCTCCTCAATTTGAGGTTGG - Intergenic
1050627747 9:7523519-7523541 GTTACTGCTCATTTGGAGCTGGG - Intergenic
1051389433 9:16548133-16548155 AAATCTTCTCATTTGCAGGTGGG - Intronic
1052050863 9:23848839-23848861 AAGTTTTCTCATTTGAAGGTTGG - Intergenic
1053064065 9:35054672-35054694 AATTCTGCTCATTGGCAACTTGG - Intergenic
1056187023 9:84145266-84145288 AATTCTCATAATTTGCAGGTGGG + Intergenic
1059426376 9:114223334-114223356 AATTCTGCTCAGAGGGAGGCTGG + Intronic
1062129669 9:134885682-134885704 AATGCTGCTCCTCTGGAGGGCGG + Intronic
1062133465 9:134912678-134912700 AATGCTGCTCCTCTGGAGGGCGG - Intronic
1186165886 X:6825502-6825524 TATTCTGCTCCTTGGGAGCTTGG + Intergenic
1186530259 X:10287918-10287940 AATTATTCTCATTTGCAGATAGG - Intergenic
1187114551 X:16335902-16335924 AATTTTGCTCATTTTTAGGAGGG + Intergenic
1191129436 X:56992639-56992661 AGTTCTGCACATTTGGGGCTGGG - Intronic
1193614255 X:83668404-83668426 TAGTGTGGTCATTTGGAGGTGGG - Intergenic
1194469752 X:94278592-94278614 AATTCTGCTTATTTGTATGTTGG + Intergenic
1197323759 X:125066338-125066360 AATTGTGCTTATTGGGAGGAGGG - Intergenic
1199215531 X:145256611-145256633 AATTTTGCTCTTTTGGAGCTTGG + Intergenic
1199548755 X:149035298-149035320 AAATTAGCTCATCTGGAGGTGGG + Intergenic
1202105265 Y:21357058-21357080 TATTCTGTTGATTTGGAGTTGGG - Intergenic