ID: 1125594270

View in Genome Browser
Species Human (GRCh38)
Location 15:40874170-40874192
Sequence GCGCAGCGAAGCCGAGACCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 78}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125594270_1125594278 18 Left 1125594270 15:40874170-40874192 CCCGGGTCTCGGCTTCGCTGCGC 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1125594278 15:40874211-40874233 CTGGCTGCCTCTGACTGAATGGG 0: 1
1: 0
2: 2
3: 41
4: 172
1125594270_1125594277 17 Left 1125594270 15:40874170-40874192 CCCGGGTCTCGGCTTCGCTGCGC 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1125594277 15:40874210-40874232 GCTGGCTGCCTCTGACTGAATGG 0: 1
1: 0
2: 5
3: 16
4: 224
1125594270_1125594281 28 Left 1125594270 15:40874170-40874192 CCCGGGTCTCGGCTTCGCTGCGC 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1125594281 15:40874221-40874243 CTGACTGAATGGGTCCAGGCTGG 0: 1
1: 0
2: 1
3: 14
4: 198
1125594270_1125594274 -1 Left 1125594270 15:40874170-40874192 CCCGGGTCTCGGCTTCGCTGCGC 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1125594274 15:40874192-40874214 CTCGGTGAAGCAGGTCCCGCTGG 0: 1
1: 0
2: 0
3: 6
4: 71
1125594270_1125594273 -10 Left 1125594270 15:40874170-40874192 CCCGGGTCTCGGCTTCGCTGCGC 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1125594273 15:40874183-40874205 TTCGCTGCGCTCGGTGAAGCAGG 0: 1
1: 0
2: 0
3: 2
4: 35
1125594270_1125594279 24 Left 1125594270 15:40874170-40874192 CCCGGGTCTCGGCTTCGCTGCGC 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1125594279 15:40874217-40874239 GCCTCTGACTGAATGGGTCCAGG 0: 1
1: 0
2: 3
3: 13
4: 136
1125594270_1125594282 29 Left 1125594270 15:40874170-40874192 CCCGGGTCTCGGCTTCGCTGCGC 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1125594282 15:40874222-40874244 TGACTGAATGGGTCCAGGCTGGG 0: 1
1: 0
2: 1
3: 16
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125594270 Original CRISPR GCGCAGCGAAGCCGAGACCC GGG (reversed) Exonic
902429510 1:16352270-16352292 GCGGAGCGAACCCGAGAGCGTGG - Exonic
905460233 1:38117743-38117765 ACTCAGGGAAGCTGAGACCCAGG + Intergenic
905889708 1:41511374-41511396 GCTCAGCTCAGCCGGGACCCTGG - Intronic
921945659 1:220884368-220884390 GAGCAGCGACTCCGAGTCCCTGG + Exonic
1066746094 10:38604908-38604930 CAGCAGCGCAGCCGAGTCCCAGG + Intergenic
1076554329 10:131311891-131311913 GCGCAGCGGGGAGGAGACCCCGG - Intergenic
1079865540 11:25729229-25729251 GTGCAGCCAGGCAGAGACCCTGG + Intergenic
1081721354 11:45291081-45291103 GCGCAGCTCAGTCCAGACCCAGG + Intergenic
1083596340 11:63919676-63919698 GGGCAGCGCGGCCGAGAACCCGG + Intergenic
1103392494 12:120584689-120584711 GCGCCGCGCAGCGGGGACCCGGG - Intergenic
1103749960 12:123151513-123151535 GCTCACCGAAGCCCAGCCCCGGG + Intergenic
1104084536 12:125461883-125461905 GCACAGCGAGGTCGAGAACCAGG - Intronic
1112506863 13:99980904-99980926 GCCCACCGCAGCCGAGACCTGGG + Intergenic
1113906635 13:113822362-113822384 GTGCAGAGAAGCTGAGCCCCAGG - Intronic
1119379924 14:74221986-74222008 GCGGGGGGAAGCCGAGACCCTGG + Intergenic
1122083238 14:99281596-99281618 GCGCAGCGGAGACTTGACCCTGG - Intergenic
1122328712 14:100898819-100898841 GCCCACCGAAGCCCTGACCCTGG + Intergenic
1125594270 15:40874170-40874192 GCGCAGCGAAGCCGAGACCCGGG - Exonic
1131466123 15:92655891-92655913 GCGGAGCGCAGCCGGGACCCAGG - Exonic
1132940014 16:2501819-2501841 GCCCAGAGAAGCCTGGACCCAGG + Exonic
1135016048 16:18926004-18926026 CCGCTGCTCAGCCGAGACCCCGG + Exonic
1135321673 16:21501849-21501871 CCGCCGCTCAGCCGAGACCCCGG + Intergenic
1135437295 16:22437416-22437438 CCGCCGCTCAGCCGAGACCCCGG - Intergenic
1136333139 16:29594929-29594951 CCGCTGCTCAGCCGAGACCCCGG + Intergenic
1136447835 16:30335017-30335039 CCGCTGCTCAGCCGAGACCCCGG + Intergenic
1136736965 16:32474733-32474755 CAGCAGCGCAGCCGAGCCCCAGG - Intergenic
1138230285 16:55331400-55331422 TCGCAGGGAAGCAGGGACCCGGG + Intergenic
1138566597 16:57837932-57837954 GCAGAGCGCAGCCCAGACCCAGG + Intronic
1203016106 16_KI270728v1_random:354844-354866 CAGCAGCGCAGCCGAGCCCCAGG + Intergenic
1203034441 16_KI270728v1_random:628002-628024 CAGCAGCGCAGCCGAGCCCCAGG + Intergenic
1143487121 17:7261275-7261297 GCGAAGAGAAGCCGAGACGGTGG + Intronic
1144956463 17:19021241-19021263 GCCCAGCCACGCAGAGACCCTGG - Exonic
1145992420 17:29087043-29087065 GCGCATTGCAGCCGAGAACCGGG - Exonic
1150654969 17:67033476-67033498 GCACAGCGTACCCCAGACCCAGG - Intergenic
1152396534 17:80036446-80036468 GCGCAGCCGAGGCGGGACCCGGG + Intergenic
1153525881 18:5994176-5994198 GCGCAGTGAACCCCAGACCCAGG + Intronic
1154318541 18:13325646-13325668 GCGCAGCGAAGCTGAGTGCCGGG - Intronic
1155047532 18:22115848-22115870 GGGGAGTGAAGACGAGACCCGGG + Intergenic
1160786184 19:901112-901134 GCGCAGGGAAGCGGGGAACCGGG + Intronic
1161175872 19:2841848-2841870 GCGCAGGGACGCGGGGACCCCGG - Intronic
1164706343 19:30323020-30323042 GAGAAGCAAAGCCAAGACCCTGG + Intronic
1165157178 19:33795926-33795948 GGGCAGCGGGGCAGAGACCCTGG + Intronic
925201064 2:1968095-1968117 GCTCAGGGAAGCCCAGCCCCAGG + Intronic
925961135 2:9017664-9017686 GCACAGACAAGCTGAGACCCGGG - Intergenic
927558184 2:24050214-24050236 GGAAAGCGAAGCCGAAACCCAGG - Intronic
927779634 2:25929005-25929027 GCGCAGAGAAGCAGAGGCCAGGG + Exonic
927836345 2:26402103-26402125 GCGCAGCGATGCGGAGGCGCCGG - Exonic
934308498 2:91844100-91844122 CAGCAGCGCAGCCGAGCCCCAGG + Intergenic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1180052757 21:45339880-45339902 TCGCAGGGGAGCCGAGACACTGG - Intergenic
1180535585 22:16391179-16391201 CAGCAGCGCAGCCGAGCCCCAGG + Intergenic
1181344828 22:22211450-22211472 GGGCAGCGAAGCCCACAGCCTGG - Intergenic
1181615467 22:24051352-24051374 GAGCGGAGAAGCCCAGACCCGGG - Intronic
1183027533 22:35076984-35077006 GGGCAGAGAAGCCGAGAAGCAGG - Intronic
950624022 3:14231079-14231101 GGTCAGAGAAGCGGAGACCCAGG - Intergenic
956938054 3:74126380-74126402 GGGCAGAGAAGGCAAGACCCTGG + Intergenic
970954507 4:21794566-21794588 GCTCAGAGAATCTGAGACCCTGG + Intronic
973686824 4:53378173-53378195 GCACAGCGAAGCCGGGGGCCAGG - Intronic
985940474 5:3131879-3131901 GGGCAGAGAAGCCCAGAGCCAGG + Intergenic
1001101381 5:168817400-168817422 TCGCAGCCAATCCGAGAGCCAGG + Exonic
1001383155 5:171316963-171316985 TCTCAGCGACGCCCAGACCCAGG + Intergenic
1001403018 5:171457331-171457353 GCGCAGGGAAGGCGTGCCCCTGG + Exonic
1005842397 6:29752376-29752398 GGGCAGCCAGGCCGGGACCCTGG - Intergenic
1005871378 6:29976450-29976472 GGGCAGCCAGGCCTAGACCCTGG - Intergenic
1020754857 7:12189812-12189834 GTGCAGTGTAGCCGTGACCCAGG - Intergenic
1024112445 7:46161106-46161128 GTGCTGCGAAGCCGAGGCCCTGG + Intergenic
1024512064 7:50212271-50212293 GCTTAGGGAAGCTGAGACCCGGG + Intergenic
1028561298 7:92179156-92179178 GCGCAGCGGAGCAGAGGGCCCGG - Intronic
1029362764 7:100099330-100099352 GAGCAGCGGAGTCGGGACCCTGG - Exonic
1037315461 8:17595585-17595607 GCTCAGCCACGCAGAGACCCTGG - Intronic
1038176433 8:25185051-25185073 GCGCAGCCGGGCCGAGCCCCCGG - Intronic
1043695240 8:83208812-83208834 TCTCAGCGAAGAGGAGACCCTGG - Intergenic
1054798650 9:69325463-69325485 GCGCAGCGAGGCCGCGACGGGGG - Intronic
1060280756 9:122214102-122214124 ACGCAGAGACTCCGAGACCCCGG + Intronic
1060970566 9:127735169-127735191 GCGCAGGGAAGCCAGGTCCCAGG + Exonic
1061330363 9:129888685-129888707 GCGCAGAGACGCTGAGGCCCAGG - Exonic
1061916566 9:133758442-133758464 GCCCAGAGAGGCCAAGACCCTGG + Intergenic
1062185991 9:135218813-135218835 GCGCAGCCAGGGCGAGAGCCAGG - Intergenic
1062537809 9:137028480-137028502 CCACATCGAATCCGAGACCCCGG + Intronic
1062720900 9:138043448-138043470 GCGCTGAGAAGCCCAGAGCCTGG - Intronic
1190106196 X:47562676-47562698 GTGCAGTGAAGCTGAGACCTTGG + Intronic
1190265921 X:48827100-48827122 GCGCAGGGAGGCCGCGGCCCTGG - Intergenic
1197701912 X:129605938-129605960 GAGCAGGGAAGGCGGGACCCTGG + Intergenic
1200111721 X:153744028-153744050 CAGCAGCGCAGCCGAGCCCCAGG + Exonic