ID: 1125598028

View in Genome Browser
Species Human (GRCh38)
Location 15:40899865-40899887
Sequence GACCGGGCAGGTGGTGCTGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 277}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125598018_1125598028 19 Left 1125598018 15:40899823-40899845 CCTGCTGCTACTGGCAGACCGGG 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1125598028 15:40899865-40899887 GACCGGGCAGGTGGTGCTGCGGG 0: 1
1: 0
2: 0
3: 22
4: 277
1125598016_1125598028 25 Left 1125598016 15:40899817-40899839 CCACTTCCTGCTGCTACTGGCAG 0: 1
1: 0
2: 6
3: 51
4: 394
Right 1125598028 15:40899865-40899887 GACCGGGCAGGTGGTGCTGCGGG 0: 1
1: 0
2: 0
3: 22
4: 277
1125598022_1125598028 1 Left 1125598022 15:40899841-40899863 CCGGGTGGAGGCAGTGTGCACAC 0: 1
1: 0
2: 1
3: 26
4: 187
Right 1125598028 15:40899865-40899887 GACCGGGCAGGTGGTGCTGCGGG 0: 1
1: 0
2: 0
3: 22
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125598028 Original CRISPR GACCGGGCAGGTGGTGCTGC GGG Exonic