ID: 1125598579

View in Genome Browser
Species Human (GRCh38)
Location 15:40903085-40903107
Sequence CTCCAGCCGGGCCTGCTTGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 150}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125598579_1125598588 20 Left 1125598579 15:40903085-40903107 CCTACAAGCAGGCCCGGCTGGAG 0: 1
1: 0
2: 1
3: 20
4: 150
Right 1125598588 15:40903128-40903150 GGCTGCTCCACCCCCAGCCAAGG 0: 1
1: 4
2: 13
3: 151
4: 1294
1125598579_1125598585 -3 Left 1125598579 15:40903085-40903107 CCTACAAGCAGGCCCGGCTGGAG 0: 1
1: 0
2: 1
3: 20
4: 150
Right 1125598585 15:40903105-40903127 GAGGAGCTGCAGAGGAAGCTGGG 0: 1
1: 0
2: 9
3: 81
4: 597
1125598579_1125598589 21 Left 1125598579 15:40903085-40903107 CCTACAAGCAGGCCCGGCTGGAG 0: 1
1: 0
2: 1
3: 20
4: 150
Right 1125598589 15:40903129-40903151 GCTGCTCCACCCCCAGCCAAGGG 0: 1
1: 0
2: 2
3: 40
4: 392
1125598579_1125598584 -4 Left 1125598579 15:40903085-40903107 CCTACAAGCAGGCCCGGCTGGAG 0: 1
1: 0
2: 1
3: 20
4: 150
Right 1125598584 15:40903104-40903126 GGAGGAGCTGCAGAGGAAGCTGG 0: 1
1: 0
2: 10
3: 128
4: 1224
1125598579_1125598586 -2 Left 1125598579 15:40903085-40903107 CCTACAAGCAGGCCCGGCTGGAG 0: 1
1: 0
2: 1
3: 20
4: 150
Right 1125598586 15:40903106-40903128 AGGAGCTGCAGAGGAAGCTGGGG 0: 1
1: 0
2: 8
3: 93
4: 871
1125598579_1125598587 -1 Left 1125598579 15:40903085-40903107 CCTACAAGCAGGCCCGGCTGGAG 0: 1
1: 0
2: 1
3: 20
4: 150
Right 1125598587 15:40903107-40903129 GGAGCTGCAGAGGAAGCTGGGGG 0: 1
1: 0
2: 25
3: 110
4: 812

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125598579 Original CRISPR CTCCAGCCGGGCCTGCTTGT AGG (reversed) Exonic
900402029 1:2476559-2476581 CGACAGCCGGGCCTGCTTCACGG - Exonic
900422320 1:2560960-2560982 CTCCCTCTGGGCCTGCTTCTGGG - Intronic
900636834 1:3670063-3670085 CTCCAGCCTGGCCTCCTGGATGG + Intronic
900641363 1:3689489-3689511 CCTCAGCCCGGCCTGCTGGTGGG + Intronic
902839844 1:19067830-19067852 GTCCAGCCAGGACTCCTTGTCGG + Intergenic
903676392 1:25067255-25067277 TTCCAGCCCGGGCAGCTTGTGGG + Intergenic
904615627 1:31748069-31748091 GACCAGCCTGACCTGCTTGTCGG + Intronic
907018021 1:51036105-51036127 CTCCTGCCGGTTCTGCTGGTTGG + Intergenic
910196291 1:84642881-84642903 CTGCTGCAGTGCCTGCTTGTAGG - Intergenic
911094340 1:94043403-94043425 CTCCAGCTGGGCCTCCTCCTGGG + Exonic
918450720 1:184655144-184655166 CTCCAGCAGGGCCTGCTGGGCGG + Intergenic
923663489 1:235979029-235979051 ATACAGCCGGGTCTGCTTGTGGG + Exonic
1066362373 10:34743833-34743855 CTGCAGCCAGGCGTGATTGTGGG - Intronic
1068949118 10:62759899-62759921 TTCCAGCCAGGCCTCCCTGTTGG - Intergenic
1069770946 10:70899559-70899581 CTGCAGCCTGTCCAGCTTGTGGG - Intergenic
1072618237 10:97063657-97063679 CCCCAGCCCAGCCTGATTGTGGG + Intronic
1077158785 11:1103305-1103327 CTCCAGCCCGTACTTCTTGTAGG - Intergenic
1082828591 11:57598629-57598651 CTCCTGCCAAGCCTGCTTGGTGG - Intronic
1083704059 11:64500966-64500988 GGCCGGCTGGGCCTGCTTGTGGG + Intergenic
1083949756 11:65947457-65947479 TTGCAGCTGGACCTGCTTGTCGG - Exonic
1084004971 11:66317813-66317835 TTCCAGCTGGGCCAGCGTGTGGG + Intergenic
1084423639 11:69072686-69072708 CTCCATCATGGCCTGTTTGTGGG - Exonic
1086380273 11:86245151-86245173 CTCGGGCCGGGCTTGCTTGACGG + Exonic
1087624474 11:100581355-100581377 CTCCAGCCGGACCTGCTGACTGG + Intergenic
1091718876 12:2797939-2797961 CTCCAGCCCTTCCTGCTTCTTGG + Intronic
1092333522 12:7607308-7607330 CACCAGCGGGGCCTGCTTGAGGG - Intergenic
1094089703 12:26634734-26634756 AACTAGCCGGGCGTGCTTGTGGG + Intronic
1102201992 12:111063609-111063631 CTCCAGCAGGGCCTGCCTTGGGG + Intronic
1103726612 12:123000346-123000368 CTCCCGCGGGGCCATCTTGTCGG + Intronic
1103739491 12:123081687-123081709 CTCCTGCAGGGCCAGCTTGGTGG - Intronic
1104794711 12:131509454-131509476 CTACAGTAGGGCCTGCTTTTTGG - Intergenic
1105897811 13:24732216-24732238 CTCCAGCCGGTCCTGCCGTTTGG + Intergenic
1106897929 13:34325113-34325135 TTCAAGCCAGGCCTGATTGTGGG + Intergenic
1107022564 13:35766416-35766438 CTCCATCCGTGCATTCTTGTTGG - Intergenic
1108245108 13:48506159-48506181 CTCCAGCTCTGCCTGCATGTTGG - Intronic
1110612234 13:77501795-77501817 CTCCAGTCAGGCCTGCATCTGGG - Intergenic
1119319089 14:73718870-73718892 CTCCCGCAGGGCCTGCTGGTGGG + Exonic
1119347234 14:73936026-73936048 CTCCAGCCCAGCCTGCTTCAGGG + Exonic
1122127241 14:99586035-99586057 CTCCAGCCCTGCCTGATTCTGGG - Intronic
1122282793 14:100634056-100634078 CTGCAGCCTGCCCTGCCTGTAGG - Intergenic
1122700122 14:103582464-103582486 CTCCAGCCCCGCGTGCTGGTGGG - Intronic
1122956282 14:105073042-105073064 CTCCACCCAGGCCTGCCTGTGGG - Intergenic
1123724520 15:23088698-23088720 ATCCAGCCGGGTCTCCATGTTGG - Intergenic
1124120370 15:26883506-26883528 CTCCAGCCGCAGCAGCTTGTTGG - Exonic
1125538976 15:40458964-40458986 CCCCAGCCGGGGCCGCTTCTTGG - Exonic
1125598579 15:40903085-40903107 CTCCAGCCGGGCCTGCTTGTAGG - Exonic
1125729079 15:41882723-41882745 CTCCAGCAGGGCCCGCCTGAGGG + Exonic
1125855008 15:42940105-42940127 CTCCAGCGGGCCCTGACTGTGGG - Intergenic
1132747353 16:1442594-1442616 CTCCTGCCTGGCCAGCCTGTGGG - Intronic
1133016374 16:2943644-2943666 CCCGCGCCTGGCCTGCTTGTGGG - Intronic
1135142827 16:19936159-19936181 CTCCAGCCCAGCCTCCTTGCTGG + Intergenic
1135772363 16:25227168-25227190 CTCCTGGCTGGCCTGCTTGTTGG + Exonic
1136548977 16:30971702-30971724 CTCCAGCAAGGCCTGCAGGTAGG + Exonic
1137447632 16:48541498-48541520 CTCCCTCCAGGCCTGCTTCTTGG - Exonic
1138385583 16:56633673-56633695 CTCCAGCCAGGCTTGCTATTGGG + Intronic
1138591037 16:58000097-58000119 CTCCCGCCGGCCCTGCCTGCAGG + Intronic
1139545134 16:67646452-67646474 CTCCAGCCGAGCCAGCATGGAGG - Exonic
1139852522 16:69959679-69959701 CTCCTGCCCGGCCTGCTGGGAGG + Intronic
1139881493 16:70182587-70182609 CTCCTGCCCGGCCTGCTGGGAGG + Intronic
1142031097 16:87839002-87839024 CCCCTGCCCAGCCTGCTTGTTGG + Intronic
1142032658 16:87846272-87846294 TTCCAGGCTGGCCTGCCTGTGGG - Intronic
1142504269 17:352852-352874 CTCCAGCTGGGCCTGCCTGGTGG - Intronic
1144071889 17:11681518-11681540 CTCCAGCTTGGCCTCCTGGTTGG - Intronic
1144715996 17:17436318-17436340 ATGCAGCCGGGGCTGCTTGTGGG + Intergenic
1146198357 17:30832283-30832305 GTCCAGCCCGGCCTGCCTGGAGG - Exonic
1146283909 17:31561600-31561622 AGCCAGCCAGGCCTGCTTTTCGG - Intergenic
1146948640 17:36890885-36890907 TCCCAGCCGGGCCTGGTGGTGGG + Intergenic
1148334478 17:46832314-46832336 CCCCAGAAGGGCCTGGTTGTTGG + Intronic
1148497099 17:48059589-48059611 CTGCCGCCGGGCCTGCTGGTCGG - Exonic
1148821381 17:50361723-50361745 CTGCAGCCTGGCCTGGTGGTGGG - Intronic
1150292092 17:63987975-63987997 CTCCAGGCTGGCCTGAGTGTTGG - Intergenic
1150484790 17:65536367-65536389 CTCCAGCTGAGCCAGCGTGTTGG + Exonic
1151455950 17:74225907-74225929 CTCCAGCTGGGCCTCCCTGATGG - Intronic
1151655638 17:75494705-75494727 GTCCAGCCGGGCCTGGTACTGGG - Exonic
1152152319 17:78609972-78609994 CAGCATCCGGGCCTGCGTGTGGG + Intergenic
1152401793 17:80070899-80070921 GTCCATCTGGGCCTGCCTGTGGG + Intronic
1152653072 17:81505219-81505241 CACCAGCCGGGCGTGGTGGTGGG + Intergenic
1152743668 17:82029610-82029632 CTCCAGGCGGGCCTGGCTCTTGG - Exonic
1160698468 19:495588-495610 CTCCAGCCAGGCCTGCTAGGTGG + Intronic
1161011509 19:1961483-1961505 CTCCAGAAGGCCCTGCTGGTGGG + Intronic
1161256954 19:3314925-3314947 CTCCAGCCAGGCGTGGTTGGGGG + Intergenic
1161316287 19:3619089-3619111 CTCCAGCAGGTCCTCCATGTCGG + Exonic
1161581930 19:5085853-5085875 CTCCAGCCTGGGCTGCTTATGGG - Intronic
1161605355 19:5211889-5211911 CTCGAGGCGGGCCTGATTTTCGG + Intronic
1162017217 19:7852188-7852210 CCCCAGCCCGGCCTGCCTGGAGG + Intronic
1162779042 19:12997032-12997054 TGCCAGCCAGGCCTGCATGTGGG + Intronic
1162948254 19:14056436-14056458 CGCCAGCTGGGCCTGCCTGAGGG + Exonic
1163501154 19:17677079-17677101 GTCCAGCCCCACCTGCTTGTGGG + Intronic
1165445128 19:35852567-35852589 CTCCAGCTGGGCCAGCTGGGAGG - Intronic
1166066927 19:40365702-40365724 CTCCAGCCTGGCCGGGTTGGGGG - Exonic
1166745194 19:45138547-45138569 CTTCTGGCAGGCCTGCTTGTAGG - Exonic
1167593248 19:50415557-50415579 CTCCACGTGGGCCTGCTTGCCGG - Exonic
926228663 2:10986294-10986316 CTCCAGCAGGGCCAGCTGGAAGG + Intergenic
926301905 2:11610924-11610946 CGCCAGCCGGGCCCGCACGTGGG - Exonic
927154013 2:20211610-20211632 GTCCAGCCGGGCCGGCTGGTGGG - Intronic
927207433 2:20619103-20619125 CTTCAGCCGGGCCCGCTTTGGGG + Exonic
927845386 2:26469346-26469368 CTCCAGCCTGGCCAACTTGATGG + Intronic
934560924 2:95312925-95312947 CACCAGCCCGGCCTCCTTGCGGG - Intronic
935600613 2:104918240-104918262 CTACATCCGGGCCTGCTGGAGGG - Intergenic
939991066 2:148876645-148876667 CTGCAGCTGGGGCTGCTGGTAGG + Intronic
946421079 2:219565193-219565215 CTCCAGCCAAGGCTGATTGTGGG - Intronic
948383302 2:237566542-237566564 CTCCAGCGGGGCCTCCTCGGAGG + Intergenic
948588445 2:239035486-239035508 CCCCAGCGGGGCCTGGGTGTGGG + Intergenic
948894666 2:240922534-240922556 CTCCAGCCGGGCCTGCAGCTGGG - Exonic
1169296604 20:4405350-4405372 CTCCTGCCGTGCAGGCTTGTTGG + Intergenic
1170059928 20:12248109-12248131 CTCCAGCCTGCCCTGTATGTAGG + Intergenic
1172194514 20:33083084-33083106 CTCCTGGGGGGCCTGCTTGGTGG + Intronic
1173878087 20:46389158-46389180 ATCCAGCCGGGTCTCCATGTTGG + Exonic
1175172964 20:57092798-57092820 CTCCAGCTGGGCCTGCGTGGAGG - Intergenic
1175581246 20:60101702-60101724 CTTCTCCAGGGCCTGCTTGTAGG - Intergenic
1181068620 22:20319124-20319146 CTTGAGCCAGGCCTGCTTGGTGG - Intronic
1181943355 22:26496230-26496252 CTCCAGCCGTGCCTGCATAAGGG + Exonic
1182598349 22:31440012-31440034 CTCCAGCTGGGAGTGCATGTGGG + Exonic
1184513313 22:44945614-44945636 CTCCAGAAGGGCCTGATCGTGGG + Intronic
1184525279 22:45019129-45019151 CTCGTGCTGGGCCTGCTTCTTGG + Intergenic
1184820925 22:46908815-46908837 CTCCTGCCGTGCCTGTTTGGTGG + Intronic
1184834787 22:47014767-47014789 CTCCAGCGCGGCCTGTGTGTGGG + Intronic
1185299350 22:50071553-50071575 CTGCAGTCGGGCCTCCGTGTGGG + Intronic
950107977 3:10400329-10400351 CTCCAGCCAGTCCTGCTTCTGGG + Intronic
953095838 3:39776069-39776091 CTCCAGCCTGGCCTGGGTGATGG - Intergenic
953536983 3:43784025-43784047 CTCCAGCCACACCTGCCTGTTGG - Intergenic
954432491 3:50478283-50478305 GTCCACCAGGGCCTGGTTGTGGG + Intronic
960945321 3:122962389-122962411 CACCCGCCGGGCCTGCATGTCGG - Intronic
961369059 3:126418663-126418685 CTCCAGCCTGGCCTCCTCTTTGG - Exonic
972592571 4:40502037-40502059 CTCCTGCTTGGCCTGCTTGAAGG + Intronic
973773648 4:54227411-54227433 CTCCCGCCCGGACTGCTTCTCGG + Intronic
977527214 4:98159849-98159871 TTCCAGCTGTGCCTGCTTATTGG + Intergenic
984514642 4:180723110-180723132 CTACTCCAGGGCCTGCTTGTAGG - Intergenic
984937172 4:184899508-184899530 GCTCAGCCAGGCCTGCTTGTGGG - Intergenic
987066051 5:14290858-14290880 CTCCAGCCGAGACAGCATGTGGG - Exonic
987090405 5:14504520-14504542 CTCCAGCACCCCCTGCTTGTCGG + Exonic
987383327 5:17306537-17306559 CTCCAGCTGGGCCCCCTTGCTGG - Intergenic
997206993 5:132055991-132056013 CTCCAGCTGGGCCCGCTCGGTGG + Intergenic
997860436 5:137410813-137410835 CTCCATCTGGGCCTCCTTGGAGG - Intronic
998040007 5:138945845-138945867 CTCCAGCCTGCCCTGCTGGGAGG + Intergenic
998125377 5:139616291-139616313 CTCCAGCCTGGCCAGCCTGGGGG + Intronic
998262460 5:140641908-140641930 CTGCAGCAGGGCCTGGTTGCTGG - Exonic
999176070 5:149632516-149632538 CTGCATCCGGGCCTGCCTGTGGG + Exonic
1000293763 5:159895165-159895187 CTCCAGCCGGCTCCACTTGTCGG - Intergenic
1001277019 5:170358481-170358503 CTCCAGCCTGGCCTGCTTGAAGG - Intronic
1001292728 5:170475660-170475682 CTGCAGCAGGGCCTCTTTGTGGG + Intronic
1001966684 5:175914566-175914588 CTCCAGCCAGGCCTGCCTGGCGG - Intergenic
1002250263 5:177924638-177924660 CTCCAGCCAGGCCTGCCTGGCGG + Intergenic
1002259424 5:177983524-177983546 CTCCACCTTGGGCTGCTTGTAGG + Intergenic
1002838446 6:885230-885252 CTCCAGCAGGGCTTGCTTTATGG - Intergenic
1007721827 6:43889771-43889793 CTCCAGCTGGGCCTGGCTGCAGG + Intergenic
1018396086 6:163379089-163379111 CTCCAGGCAGGCCTGCCTGCTGG + Intergenic
1018930850 6:168239451-168239473 TGCCAGCCGGGCCTGCAGGTGGG - Intergenic
1019303485 7:321509-321531 CTCCAGCCAGGCCTGCAGGGAGG + Intergenic
1019418145 7:936787-936809 CCACAGCCGCACCTGCTTGTGGG - Intronic
1019571650 7:1715591-1715613 CTGCAGCCTGGCCTGCCTGCAGG - Intronic
1019779423 7:2930719-2930741 CATCAGCCAGCCCTGCTTGTCGG - Intronic
1022310912 7:29194959-29194981 CTCCAGCCTGTCCGGCTCGTCGG + Exonic
1023587759 7:41748927-41748949 TTCCAGCTGTGCCTGCTTATTGG - Intergenic
1024317520 7:48035461-48035483 CTCCAGCCGCGCCCGCCGGTTGG + Intergenic
1024993836 7:55255781-55255803 TTCCTGCCGGGCCAGCTTTTCGG - Intronic
1025611672 7:63080247-63080269 CTCCAGCAGGGCCTGCGGGGAGG + Intergenic
1033556754 7:142494863-142494885 TTCCAGACTGGCATGCTTGTAGG - Intergenic
1035446924 7:158949491-158949513 GTCCACCCCGCCCTGCTTGTTGG + Intronic
1036672925 8:10805201-10805223 CTCCTGCAGGGCGTGCTTGGAGG + Intronic
1039966606 8:42288653-42288675 CTCCTGCCGGCACTGCTTGATGG - Exonic
1044303525 8:90611800-90611822 TTCCAGCTGTGCCTGCTTATTGG + Intergenic
1048326600 8:133443850-133443872 CTCCATCAGGGCCTCATTGTAGG + Intergenic
1049682830 8:143927324-143927346 CTCCAGCAGGGCCTGGGTGATGG + Exonic
1049770028 8:144375507-144375529 CTGCGGCCGGGCCTGTCTGTGGG + Intronic
1051369103 9:16343252-16343274 ATCCAGCCGGGCCTGCCGGGAGG + Intergenic
1053209006 9:36211746-36211768 CACCAGCGGGGCCTGCTTGAGGG - Exonic
1054451771 9:65407127-65407149 CTGCAGCCAGGCCCGCTTGCAGG - Intergenic
1186582329 X:10833627-10833649 CCCCAGCCCAGCCTGCTTGAAGG - Intronic
1190317737 X:49162716-49162738 CTACAGCCAGGCCTCCTTGCTGG + Intronic
1194294857 X:92114979-92115001 CCCCAGCCGGGCATGGTAGTGGG - Intronic
1194821128 X:98508643-98508665 CTCCAGCCGGTCCCTCTTTTCGG + Intergenic