ID: 1125600640

View in Genome Browser
Species Human (GRCh38)
Location 15:40913777-40913799
Sequence CCCACTGTGTAGATAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125600624_1125600640 26 Left 1125600624 15:40913728-40913750 CCATCCCCCCAACAAATGCCTCA No data
Right 1125600640 15:40913777-40913799 CCCACTGTGTAGATAGAGGAAGG No data
1125600625_1125600640 22 Left 1125600625 15:40913732-40913754 CCCCCCAACAAATGCCTCACTGG No data
Right 1125600640 15:40913777-40913799 CCCACTGTGTAGATAGAGGAAGG No data
1125600622_1125600640 30 Left 1125600622 15:40913724-40913746 CCTCCCATCCCCCCAACAAATGC No data
Right 1125600640 15:40913777-40913799 CCCACTGTGTAGATAGAGGAAGG No data
1125600634_1125600640 -1 Left 1125600634 15:40913755-40913777 CCCCATATAGGCCACTGTGGAGC No data
Right 1125600640 15:40913777-40913799 CCCACTGTGTAGATAGAGGAAGG No data
1125600628_1125600640 20 Left 1125600628 15:40913734-40913756 CCCCAACAAATGCCTCACTGGCC No data
Right 1125600640 15:40913777-40913799 CCCACTGTGTAGATAGAGGAAGG No data
1125600635_1125600640 -2 Left 1125600635 15:40913756-40913778 CCCATATAGGCCACTGTGGAGCC No data
Right 1125600640 15:40913777-40913799 CCCACTGTGTAGATAGAGGAAGG No data
1125600629_1125600640 19 Left 1125600629 15:40913735-40913757 CCCAACAAATGCCTCACTGGCCC No data
Right 1125600640 15:40913777-40913799 CCCACTGTGTAGATAGAGGAAGG No data
1125600630_1125600640 18 Left 1125600630 15:40913736-40913758 CCAACAAATGCCTCACTGGCCCC No data
Right 1125600640 15:40913777-40913799 CCCACTGTGTAGATAGAGGAAGG No data
1125600627_1125600640 21 Left 1125600627 15:40913733-40913755 CCCCCAACAAATGCCTCACTGGC No data
Right 1125600640 15:40913777-40913799 CCCACTGTGTAGATAGAGGAAGG No data
1125600623_1125600640 27 Left 1125600623 15:40913727-40913749 CCCATCCCCCCAACAAATGCCTC No data
Right 1125600640 15:40913777-40913799 CCCACTGTGTAGATAGAGGAAGG No data
1125600636_1125600640 -3 Left 1125600636 15:40913757-40913779 CCATATAGGCCACTGTGGAGCCC No data
Right 1125600640 15:40913777-40913799 CCCACTGTGTAGATAGAGGAAGG No data
1125600632_1125600640 8 Left 1125600632 15:40913746-40913768 CCTCACTGGCCCCATATAGGCCA No data
Right 1125600640 15:40913777-40913799 CCCACTGTGTAGATAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125600640 Original CRISPR CCCACTGTGTAGATAGAGGA AGG Intergenic
No off target data available for this crispr