ID: 1125601941

View in Genome Browser
Species Human (GRCh38)
Location 15:40920163-40920185
Sequence CAGGGTAGTCTGGAGCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125601941_1125601948 6 Left 1125601941 15:40920163-40920185 CCTCCCTGCTCCAGACTACCCTG No data
Right 1125601948 15:40920192-40920214 ACTGCCAGAAAGCATGCAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125601941 Original CRISPR CAGGGTAGTCTGGAGCAGGG AGG (reversed) Intergenic
No off target data available for this crispr