ID: 1125605587

View in Genome Browser
Species Human (GRCh38)
Location 15:40938089-40938111
Sequence GCATTGTTTACATTGCATCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 118}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125605576_1125605587 23 Left 1125605576 15:40938043-40938065 CCTACCTGGACATCCCTGCTCAG 0: 1
1: 0
2: 1
3: 19
4: 230
Right 1125605587 15:40938089-40938111 GCATTGTTTACATTGCATCCTGG 0: 1
1: 0
2: 2
3: 16
4: 118
1125605577_1125605587 19 Left 1125605577 15:40938047-40938069 CCTGGACATCCCTGCTCAGCCCC 0: 1
1: 0
2: 0
3: 48
4: 457
Right 1125605587 15:40938089-40938111 GCATTGTTTACATTGCATCCTGG 0: 1
1: 0
2: 2
3: 16
4: 118
1125605581_1125605587 9 Left 1125605581 15:40938057-40938079 CCTGCTCAGCCCCGCGGCTGGAC 0: 1
1: 0
2: 2
3: 18
4: 177
Right 1125605587 15:40938089-40938111 GCATTGTTTACATTGCATCCTGG 0: 1
1: 0
2: 2
3: 16
4: 118
1125605583_1125605587 -1 Left 1125605583 15:40938067-40938089 CCCGCGGCTGGACCTTCCTTCTG 0: 1
1: 0
2: 0
3: 14
4: 158
Right 1125605587 15:40938089-40938111 GCATTGTTTACATTGCATCCTGG 0: 1
1: 0
2: 2
3: 16
4: 118
1125605582_1125605587 0 Left 1125605582 15:40938066-40938088 CCCCGCGGCTGGACCTTCCTTCT 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1125605587 15:40938089-40938111 GCATTGTTTACATTGCATCCTGG 0: 1
1: 0
2: 2
3: 16
4: 118
1125605580_1125605587 10 Left 1125605580 15:40938056-40938078 CCCTGCTCAGCCCCGCGGCTGGA 0: 1
1: 0
2: 2
3: 14
4: 206
Right 1125605587 15:40938089-40938111 GCATTGTTTACATTGCATCCTGG 0: 1
1: 0
2: 2
3: 16
4: 118
1125605584_1125605587 -2 Left 1125605584 15:40938068-40938090 CCGCGGCTGGACCTTCCTTCTGC 0: 1
1: 0
2: 0
3: 13
4: 205
Right 1125605587 15:40938089-40938111 GCATTGTTTACATTGCATCCTGG 0: 1
1: 0
2: 2
3: 16
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125605587 Original CRISPR GCATTGTTTACATTGCATCC TGG Exonic
904455228 1:30643580-30643602 TCATTGTTTTCATTACATCTGGG - Intergenic
905466621 1:38159219-38159241 GTAATGTATACACTGCATCCTGG - Intergenic
907183818 1:52593651-52593673 GTATAGTTTACATTGCATCCTGG + Intergenic
907927155 1:58965688-58965710 GCCGTGTTCACATAGCATCCAGG - Intergenic
909137748 1:71822634-71822656 GCATTGTTTCCCTTGCATTCTGG + Intronic
911215581 1:95189363-95189385 TCACTGTTTGCATTGCATCCTGG + Intronic
912176789 1:107168618-107168640 TCATATTTTAAATTGCATCCTGG + Intronic
912863513 1:113236495-113236517 GCATTTCTTTCCTTGCATCCCGG - Intergenic
913491514 1:119384188-119384210 GCATTCTTTACATTGCAAAGTGG - Intronic
914254123 1:145946916-145946938 GGATTTTTTACATTGCAGACAGG - Intronic
916361411 1:163974060-163974082 GCATTATTTTCATTTCATTCGGG - Intergenic
917962802 1:180157818-180157840 GCATTGTTTGCATTGCAGTTGGG + Intronic
921738850 1:218660388-218660410 GCATGGTTAACATTCCATCCTGG - Intergenic
922474548 1:225898275-225898297 GCATTGTTGACATTTCATAAAGG + Intronic
923058648 1:230449785-230449807 GCATTATGTACATTGAATCTTGG - Intergenic
924453100 1:244197258-244197280 TCATTGCCTCCATTGCATCCAGG + Intergenic
1062783898 10:244101-244123 AAATTGTTCACATTGTATCCAGG - Intronic
1063055401 10:2498964-2498986 ACATTGATTTTATTGCATCCTGG + Intergenic
1066274693 10:33857140-33857162 CCATTGTTTATAATGCATCAGGG + Intergenic
1080453244 11:32396146-32396168 GCAGTGCTTACTTTCCATCCTGG + Intronic
1081345155 11:41976335-41976357 GAATTATTTACATTTCCTCCTGG + Intergenic
1081599094 11:44480014-44480036 TCATTGATAACATTGCTTCCTGG + Intergenic
1084592159 11:70097032-70097054 GCATTCTTTACTATGTATCCTGG + Intronic
1087568501 11:99894188-99894210 GCATAGTTCACATTTCAACCTGG + Intronic
1090729216 11:129555307-129555329 GCATTGCATGCATTGCATGCTGG - Intergenic
1095347033 12:41162617-41162639 GCATTGTGTAAATAGCATCAGGG - Intergenic
1100683146 12:96952123-96952145 GTATTGTTTTCATGGCCTCCAGG + Exonic
1103659350 12:122501106-122501128 TCATTGTCTGCATTGCATCCTGG + Intergenic
1104528920 12:129550484-129550506 CCTTTGTTGACATTGCATCTTGG + Intronic
1105825575 13:24119722-24119744 GAATTGTTTACAGTGAAGCCAGG - Intronic
1106578393 13:30997267-30997289 GCAGTGTTTACAATGCATTCTGG + Intergenic
1106977316 13:35235847-35235869 TCATTGTTATCAGTGCATCCAGG + Intronic
1109191106 13:59325288-59325310 ACATTGTTTACATTAAATGCTGG + Intergenic
1110681671 13:78320993-78321015 ACACTGTTTTTATTGCATCCTGG + Intergenic
1116148968 14:41113144-41113166 GCATTTTTAAAATTGTATCCTGG - Intergenic
1118456363 14:65948599-65948621 GAATTCTTGACATTGCAGCCAGG - Intergenic
1119844172 14:77816116-77816138 GCATTTTTGAAATGGCATCCAGG + Intronic
1120179047 14:81324591-81324613 TCATTGTTTAAATCACATCCAGG - Intronic
1125605587 15:40938089-40938111 GCATTGTTTACATTGCATCCTGG + Exonic
1127801466 15:62480867-62480889 GCATTGCTTTCTTTGCTTCCTGG + Intronic
1129930162 15:79403919-79403941 TCATTGTATATATTGCATTCTGG + Intronic
1130872053 15:87979249-87979271 GCATTGTTCTCTTTGGATCCAGG - Intronic
1134125367 16:11612598-11612620 GCCTTGTTAACTTTCCATCCAGG - Intronic
1135061292 16:19273282-19273304 GCATTGTTAATTTTACATCCTGG - Intergenic
1137350166 16:47706380-47706402 GCATTATTTACATTGTTTACAGG - Intergenic
1138891047 16:61144496-61144518 TCATAGTTTATATTGCATCCTGG + Intergenic
1144226532 17:13154359-13154381 GTATCATTTACATTGCATACTGG + Intergenic
1144489099 17:15692745-15692767 GAAATGTTTCCATTACATCCAGG + Intergenic
1144911869 17:18689218-18689240 GAAATGTTTCCATTACATCCAGG - Intergenic
1149132117 17:53315543-53315565 GCATTGATTTCTTTGCATTCAGG + Intergenic
1149254058 17:54804772-54804794 GCCTTATTTACATTCCAGCCTGG - Intergenic
1151738490 17:75961992-75962014 GCATTATTGAAATTGCATCGAGG - Intronic
1153185051 18:2477017-2477039 GAATTTTTTACATTGCTTTCAGG + Intergenic
1153590375 18:6667946-6667968 GGATTTTTTAAATTGCTTCCAGG + Intergenic
1154509473 18:15081044-15081066 CCATTCTCTACATTGCATCCAGG - Intergenic
1155619800 18:27765270-27765292 GCATGGTTTAGATTCCATCCTGG + Intergenic
1156190277 18:34711212-34711234 GCGTTGTTTACATATCACCCTGG + Intronic
1167612627 19:50514729-50514751 GCAGTGTTTCCATGGCAACCAGG + Intergenic
1168209298 19:54878267-54878289 ACATTGTTTTCATTGCCTCATGG - Intronic
926817792 2:16817385-16817407 GAAGTGTTTTCATTGCTTCCAGG + Intergenic
927998834 2:27506021-27506043 GAATTGTTTCCAGTGGATCCTGG + Intronic
928115829 2:28544659-28544681 TCATTGTTCACATTGCTTCTTGG - Intronic
928136107 2:28688607-28688629 GCATTGTTGGCCTTGAATCCAGG - Intergenic
928745613 2:34411212-34411234 GCATGGTTTACATTGTTTCTAGG - Intergenic
929035267 2:37684934-37684956 CCATATTTTACATTTCATCCTGG - Intronic
929417336 2:41756750-41756772 ACATAGTCTACATTTCATCCTGG - Intergenic
931341360 2:61404324-61404346 ACATTGTTTCCTGTGCATCCTGG - Intronic
932835533 2:75032345-75032367 GCCTTGTTTAACTTGCAACCAGG + Intergenic
933972961 2:87484930-87484952 GCATTGTTTACTTCTTATCCAGG + Intergenic
936320760 2:111465283-111465305 GCATTGTTTACTTCTTATCCAGG - Intergenic
939129184 2:138213816-138213838 GCATTCTTTGCATTCCATGCAGG + Intergenic
940348245 2:152650565-152650587 GCATTTATTAGATTGCACCCTGG - Intergenic
941136511 2:161723895-161723917 GTGTTGTAGACATTGCATCCTGG + Intronic
941273891 2:163465754-163465776 GCATTGTGTACACTGCCTTCTGG - Intergenic
948051248 2:234981077-234981099 GCATTGCAGACACTGCATCCCGG + Intronic
1169640183 20:7742626-7742648 GCAGTGTTTACATTCAATCCTGG + Intergenic
1170687014 20:18578391-18578413 GCATGGTTTTCATTCCATCAGGG - Intronic
1171005875 20:21465401-21465423 ACATTGTCTGCATTTCATCCTGG - Intergenic
1175940176 20:62534134-62534156 GCATTCTTGAAATTGCCTCCTGG + Intergenic
1176788607 21:13290780-13290802 CCATTCTCTACATTGCATCCAGG + Intergenic
1176897607 21:14400611-14400633 ACATTGTTTTTATTGCATGCTGG - Intergenic
1177987758 21:27998922-27998944 CCACTCTCTACATTGCATCCAGG + Intergenic
1178642143 21:34353499-34353521 GCATTGTACACATTGCATACTGG - Intergenic
1183760496 22:39812045-39812067 GCATTGTTTACATGGGCTTCAGG - Intronic
1184172984 22:42770220-42770242 CCATTGTTTGCACTGCGTCCCGG - Intergenic
1185015942 22:48342666-48342688 GCATATTTTACATTCCATCAGGG - Intergenic
949991285 3:9581429-9581451 CCAGTGTTTATATTTCATCCTGG + Intergenic
954719198 3:52545706-52545728 GAATTGTTTATATTGCAAACGGG - Intronic
956865757 3:73367054-73367076 GCCTTGTTTTCATTGCATCTGGG + Intergenic
959218608 3:103484498-103484520 GGATTCTTTCCATTTCATCCAGG - Intergenic
973112459 4:46412775-46412797 CCAGTGTTAACATTCCATCCAGG + Intronic
975654520 4:76628434-76628456 GCATTGTTCACATTTCCTCTTGG - Intronic
975915026 4:79314492-79314514 GCATTTTTAACATAGCACCCAGG + Intronic
978437394 4:108700305-108700327 ACATTGTTAACATTGATTCCTGG + Intergenic
979878200 4:125920313-125920335 GCATTATTTAATTTGCATGCAGG + Intergenic
980843900 4:138300951-138300973 GCACAGATTACATTGTATCCTGG + Intergenic
986298454 5:6459062-6459084 GCATTGTTCACATTGGATGAAGG - Intronic
992852123 5:80821428-80821450 ACATTGTTTTCACTTCATCCTGG + Intronic
994806550 5:104455206-104455228 GCATAGTTTAAATTCCATTCTGG + Intergenic
997346619 5:133196811-133196833 GCATTGGTGACTTTGCCTCCTGG + Exonic
999684539 5:154090477-154090499 GCATTCTGTACAATGCATACTGG + Intronic
1004480055 6:16010368-16010390 CCATTGTTTTCATTCCTTCCTGG - Intergenic
1005519912 6:26590895-26590917 GCATTGCTTTCATTGCATCTTGG + Intergenic
1007318241 6:41007442-41007464 GAAGTGTTTACTGTGCATCCAGG + Intergenic
1011010984 6:82704011-82704033 TCATTTTTTAAATTTCATCCAGG + Intergenic
1014333707 6:120103490-120103512 ACATAGTTGACATTGAATCCTGG + Intergenic
1014624623 6:123710525-123710547 GCTGTGATTGCATTGCATCCTGG + Intergenic
1015803357 6:137083294-137083316 CCATTGTTTTCACAGCATCCAGG - Intergenic
1016380452 6:143473155-143473177 GCCTTGTTTTCATTGCCTGCAGG + Intronic
1022387404 7:29914727-29914749 CCATTTTTTGCATTGCATCTTGG + Exonic
1027532874 7:79357248-79357270 GGCTTGTTGACAATGCATCCTGG + Intronic
1027760765 7:82276493-82276515 ACATAGTTTACATTGCTACCTGG - Intronic
1032277216 7:130468807-130468829 TCATAGTTTACATTCCATCCTGG + Intergenic
1032992738 7:137411931-137411953 ACACTGTGCACATTGCATCCTGG + Intronic
1035299056 7:157885350-157885372 GCATTGGACACAATGCATCCTGG + Intronic
1035914668 8:3606222-3606244 GCATTTCTCACACTGCATCCTGG - Intronic
1036641557 8:10587494-10587516 GCATTGTTTACTTAAAATCCAGG + Intergenic
1037509608 8:19569009-19569031 GCAGTGTTAAAATTGCATCATGG - Intronic
1038257840 8:25966966-25966988 GCATTGTTGACATTGGCTCTAGG - Intronic
1039728600 8:40250259-40250281 GCATGGTTTCCATTGCCTACTGG - Intergenic
1046482204 8:114837157-114837179 GCATTGGTAACATTGCATCCCGG - Intergenic
1048845928 8:138603663-138603685 TCATTGTTTACTCTGCTTCCTGG - Intronic
1048964469 8:139605297-139605319 GCTTTGGTTTCATTGCCTCCTGG + Intronic
1051833382 9:21306973-21306995 CAATTGTTTACATAGCATGCAGG + Intergenic
1051916256 9:22211466-22211488 AAATTCTTTACATTGAATCCTGG + Intergenic
1058634321 9:107021655-107021677 GCAGTGTTTACATTTAAACCAGG - Intergenic
1186292082 X:8111416-8111438 GCATTTATTACATTCCATCAAGG + Intergenic
1190426198 X:50336258-50336280 GCATTGGTTACATTGCAGCATGG + Intronic
1191669955 X:63739755-63739777 GGATTGTTAAGATTTCATCCAGG - Intronic
1192126958 X:68510066-68510088 GCTTTCTTTAGATTTCATCCAGG + Intronic
1194554000 X:95335537-95335559 TCATTGTTTCCATTTCACCCTGG - Intergenic
1195789617 X:108568801-108568823 ACCTTGGTTCCATTGCATCCGGG - Exonic
1196360266 X:114846076-114846098 GAAATTTTTACATTTCATCCAGG - Intronic
1197144146 X:123152741-123152763 GCATTGTTTGCATTCCCACCAGG - Intergenic
1199442046 X:147879350-147879372 TCATTTTTTACAGTGAATCCTGG - Intergenic
1199822333 X:151461888-151461910 GGATTGTTTACAGTGCCTCCTGG - Intergenic
1200373368 X:155751806-155751828 CCTTTTTTTATATTGCATCCTGG - Intergenic