ID: 1125605618

View in Genome Browser
Species Human (GRCh38)
Location 15:40938298-40938320
Sequence CCCTGAAGGCCACTACTGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 138}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125605618_1125605626 -9 Left 1125605618 15:40938298-40938320 CCTGCCAGTAGTGGCCTTCAGGG 0: 1
1: 0
2: 0
3: 11
4: 138
Right 1125605626 15:40938312-40938334 CCTTCAGGGGGCTCCTTCCGGGG 0: 1
1: 0
2: 1
3: 17
4: 146
1125605618_1125605624 -10 Left 1125605618 15:40938298-40938320 CCTGCCAGTAGTGGCCTTCAGGG 0: 1
1: 0
2: 0
3: 11
4: 138
Right 1125605624 15:40938311-40938333 GCCTTCAGGGGGCTCCTTCCGGG 0: 1
1: 0
2: 0
3: 23
4: 193
1125605618_1125605631 18 Left 1125605618 15:40938298-40938320 CCTGCCAGTAGTGGCCTTCAGGG 0: 1
1: 0
2: 0
3: 11
4: 138
Right 1125605631 15:40938339-40938361 GGCCTGTTTTCCAGAGAGAGTGG 0: 1
1: 0
2: 1
3: 16
4: 220
1125605618_1125605627 -3 Left 1125605618 15:40938298-40938320 CCTGCCAGTAGTGGCCTTCAGGG 0: 1
1: 0
2: 0
3: 11
4: 138
Right 1125605627 15:40938318-40938340 GGGGGCTCCTTCCGGGGCTCCGG 0: 1
1: 0
2: 3
3: 30
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125605618 Original CRISPR CCCTGAAGGCCACTACTGGC AGG (reversed) Exonic
900507972 1:3039119-3039141 CCCAGAAGGCCACGTCTGCCCGG + Intergenic
900637596 1:3673644-3673666 CCCTGAAGCCCAGCACTGCCGGG - Intronic
900804741 1:4760010-4760032 CTCTGAAGGCCAGTGCTGGGGGG - Intronic
901325607 1:8363492-8363514 CCCTTATGGCCCCTTCTGGCAGG - Intronic
903223946 1:21884645-21884667 CCCTGACGGCCACTTCTACCTGG - Exonic
903954749 1:27017586-27017608 CCCTGAAGGCCAAAACTAGGAGG + Intergenic
904383661 1:30127859-30127881 CCCTGATGGCCACTTCTTGCAGG - Intergenic
912497718 1:110102160-110102182 CCATGATGGGCACTCCTGGCCGG - Intergenic
913608574 1:120489382-120489404 CCCTGCCGGACACTGCTGGCGGG - Intergenic
913986854 1:143573290-143573312 CCCTGCTGGACACTGCTGGCAGG + Intergenic
914582627 1:149032456-149032478 CCCTGCCGGACACTGCTGGCGGG + Exonic
919608424 1:199715276-199715298 CACTGAGGCCCACTACTGGGGGG + Intergenic
920676841 1:208044013-208044035 CTCTGAAGGCCGCCACTTGCTGG - Intronic
924061698 1:240181673-240181695 CCCTGAAGGATAAGACTGGCTGG + Intronic
1068990654 10:63147117-63147139 CCCTGAAGTCTTCTGCTGGCAGG + Intronic
1069382230 10:67852778-67852800 CCCTGAAGGCAACTACTTTATGG - Intergenic
1069920544 10:71813036-71813058 CCCTTAAGGCCACCGCAGGCTGG - Intronic
1072685473 10:97534019-97534041 CCCTGAAGCCTTCTACTGCCTGG + Intronic
1074180713 10:111060252-111060274 CCCTGTAGGCCACCCCTGGTGGG + Intergenic
1075581433 10:123621570-123621592 CCCTGAAGGCCAGCACTGCTGGG + Intergenic
1081794095 11:45807892-45807914 CCCCTGAGGCCACTCCTGGCAGG - Intronic
1083325122 11:61869266-61869288 CCTTGAAGGCCACTGCCAGCGGG - Intergenic
1083519497 11:63295493-63295515 CCCTGTGGGGGACTACTGGCAGG - Intronic
1085349625 11:75790180-75790202 CACTGCAGGCCACTCCTGGGGGG - Exonic
1091046855 11:132332816-132332838 CCCTGGAGGCTTCCACTGGCAGG + Intronic
1091923062 12:4321116-4321138 CCCCGAAGGCCACTCAGGGCCGG - Intergenic
1097079901 12:56422311-56422333 CACTGTAGGCCTCTGCTGGCTGG - Intronic
1097756394 12:63411115-63411137 TCCTGAAGGCCATCACTTGCTGG - Intergenic
1099365994 12:81765821-81765843 CCCTGAAGGACACTAGTGAAGGG + Intergenic
1104106218 12:125662049-125662071 CCCCAAAGCACACTACTGGCTGG - Exonic
1108261966 13:48667398-48667420 CCCTGCAAGCCACTCCTGGCAGG - Intronic
1119851683 14:77870873-77870895 CCCTGCAGGCCACTCAGGGCTGG + Intronic
1122325181 14:100877522-100877544 TCCTGAAGGCCACCCCTGGGGGG - Intergenic
1122848228 14:104512431-104512453 CCCTGAAGGCCCCCTGTGGCAGG - Intronic
1202839886 14_GL000009v2_random:111745-111767 CCCAGAAGGACTCTAGTGGCTGG - Intergenic
1202909269 14_GL000194v1_random:101943-101965 CCCAGAAGGACTCTAGTGGCTGG - Intergenic
1202884004 14_KI270722v1_random:87333-87355 CCCAGAAGGACTCTAGTGGCTGG + Intergenic
1125115085 15:36080964-36080986 CCCTGTTGGCCACTCCTGGCAGG + Intergenic
1125605618 15:40938298-40938320 CCCTGAAGGCCACTACTGGCAGG - Exonic
1125714084 15:41809481-41809503 ATCTGAACGCCACTACTGGCTGG - Intronic
1126688438 15:51267893-51267915 GCCTGAACGCCACAACTGGTTGG + Intronic
1127653442 15:61032347-61032369 CCCAGAAGGGCACTATTTGCAGG - Intronic
1132219991 15:100098227-100098249 CCCTCCAGGTCACTACTGGATGG - Intronic
1133028491 16:2998737-2998759 CCCTAGAAGCCACTACAGGCCGG + Intergenic
1133130504 16:3673645-3673667 CCCTGGAGGCCACACCTGGCTGG + Intronic
1136111236 16:28064481-28064503 CCCTGTAGGGCACCACTGCCTGG - Intergenic
1136695808 16:32080571-32080593 GCCTGATGGCCACTAGTGACTGG - Intergenic
1136796304 16:33023824-33023846 GCCTGATGGCCACTAGTGACTGG - Intergenic
1136873613 16:33830573-33830595 GCCTGATGGCCACTAGTGACTGG + Intergenic
1137459690 16:48649382-48649404 CCCTGCAGGCCCCTCCTGGCAGG - Intergenic
1140267828 16:73435634-73435656 CCCTGAAGGGCAAAACTGCCCGG + Intergenic
1140296873 16:73717424-73717446 CACTGGAGGCCACCACTGTCTGG + Intergenic
1140921141 16:79540017-79540039 TCCTGAAGCCCACTGCTGGGAGG + Intergenic
1203098561 16_KI270728v1_random:1285483-1285505 GCCTGATGGCCACTAGTGACTGG - Intergenic
1143238974 17:5427824-5427846 CACTGATGGCCACTCATGGCAGG - Intronic
1143308425 17:5968382-5968404 ACCTCAAGGCCAGCACTGGCAGG + Intronic
1145956965 17:28861320-28861342 CCCTGAAGCAGACTACTGGAAGG - Intergenic
1147873086 17:43601514-43601536 CACTGCAGGCCGCTCCTGGCAGG + Intergenic
1149529928 17:57386967-57386989 CTCTGAAGGGCACTTCTGCCTGG - Intronic
1150170158 17:62986348-62986370 CCCTGAAGGCTGCTCCTGGCAGG - Intergenic
1151697455 17:75724797-75724819 CCCTGCAGCCCCCTCCTGGCAGG + Intronic
1152060946 17:78074830-78074852 CCCTGAGGGCCAGCAGTGGCTGG + Intronic
1154389279 18:13922777-13922799 CCCTGCAGGTCACCACAGGCTGG - Intergenic
1154493023 18:14935505-14935527 ACCTGCAGGCCACCACTGACAGG + Intergenic
1161513558 19:4684541-4684563 CGCAGAAGGGCACTTCTGGCTGG - Intronic
1162358684 19:10203908-10203930 GCCTGAAGGCCAAATCTGGCTGG - Intronic
1162967658 19:14163669-14163691 CCCTGAAGGCCATTAAGAGCGGG + Intronic
1163338099 19:16686777-16686799 CCCTGAAGACCCCTCCTGGGTGG - Intronic
1165793467 19:38505840-38505862 CCCTGAAGGCCATGATTGCCTGG + Exonic
929118588 2:38465431-38465453 CCCTGCAGGCCACCAGGGGCAGG - Intergenic
930237583 2:48902760-48902782 CCCTGGAGGCAAATACTGGCAGG + Intergenic
931827474 2:66016775-66016797 CCCTGGAGGCCACCACTCTCAGG + Intergenic
932124512 2:69131712-69131734 CCATGATGGCACCTACTGGCAGG + Intronic
935713504 2:105919485-105919507 CCCTGAAGGCCAGACCAGGCAGG - Intergenic
938499080 2:131820992-131821014 ACATGAAGGCCACACCTGGCAGG + Intergenic
939338469 2:140862220-140862242 GCCTAAAGGCTAATACTGGCCGG + Intronic
940858191 2:158746155-158746177 GCCTGACGGGCACTCCTGGCTGG + Intergenic
945719103 2:213396631-213396653 CTCTGCAGGACACTATTGGCAGG + Intronic
948125069 2:235558548-235558570 TCCTGAAGGCTACGACTGGAGGG - Intronic
949021631 2:241744081-241744103 CCCAGAAGCCCACCACTGCCGGG - Intronic
1169131872 20:3170040-3170062 CCCTGAAGGCCAAGATTGGGGGG + Intronic
1172393897 20:34585363-34585385 CCCTCAAGGCTACTAGAGGCAGG + Intronic
1173758357 20:45538209-45538231 CCCTGAGGGCCACTACCTTCTGG - Intronic
1175490618 20:59378694-59378716 CCCTGAAGGAAACCCCTGGCTGG + Intergenic
1175571535 20:60026499-60026521 CCTTCAAAGCCACTAATGGCAGG - Intronic
1175634360 20:60568288-60568310 CTATGAAAGCCACTACTGACTGG - Intergenic
1175804933 20:61821891-61821913 CCCTGAAGGGCCCACCTGGCTGG - Intronic
1176645383 21:9344696-9344718 CCCAGAAGGACTCTAGTGGCTGG + Intergenic
1179243186 21:39609651-39609673 CCCTGAAGTCCCGTTCTGGCAGG + Exonic
1179806973 21:43845560-43845582 CCCTGAAGGCCCCAACAGGGAGG - Intergenic
1180326892 22:11438032-11438054 CCCAGAAGGACTCTAGTGGCTGG + Intergenic
1180378513 22:12116795-12116817 CCCAGAAGGACTCTAGTGGCTGG + Intergenic
1181314981 22:21965032-21965054 CCCTGAAGGTGACATCTGGCTGG + Intronic
950967946 3:17159425-17159447 CCATGAAGGCCTCCACTGCCCGG + Intronic
955912991 3:63877485-63877507 GCCTGAAGGCAACACCTGGCGGG - Intronic
957094936 3:75769347-75769369 CCCAGAAGGACTCTAGTGGCTGG - Intronic
960581965 3:119288854-119288876 CACTGAAGAACACTCCTGGCAGG - Intergenic
961060772 3:123826244-123826266 CCCTGTGGGCCACCTCTGGCAGG + Intronic
962915014 3:139893429-139893451 CCCTGAAAGACACTATTGACAGG - Intergenic
963878615 3:150503588-150503610 CCCTGAGGGCCACTAGGGGTAGG - Intergenic
965349643 3:167597381-167597403 CCCTGCAGCCCACTTCTGCCTGG - Intronic
965760365 3:172068983-172069005 CCCTGAAGACCACAACTGCCTGG - Intronic
1202741505 3_GL000221v1_random:60372-60394 CCCAGAAGGACTCTAGTGGCTGG - Intergenic
969496508 4:7529446-7529468 AGCTGCAGGCCACTCCTGGCAGG + Intronic
969534504 4:7747565-7747587 CCCTGAAGGCCTCGTCTGGCTGG - Intergenic
970758686 4:19456473-19456495 CCCTGGCGTCCACTACTGTCTGG + Intergenic
972361427 4:38328945-38328967 CACTGAATCCCATTACTGGCTGG - Intergenic
976690675 4:87864125-87864147 CCCTTCAGGCCACTTCTTGCGGG - Intergenic
980448069 4:132937893-132937915 CCATGAGGGCCACTGGTGGCAGG - Intergenic
981864527 4:149399704-149399726 CTCTGAATGCAACTTCTGGCAGG + Intergenic
1202760133 4_GL000008v2_random:102261-102283 CCCAGAAGGACTCTAGTGGCTGG + Intergenic
987337021 5:16906108-16906130 CCTTGAAGGCAACTCCTGCCTGG + Intronic
994385725 5:99129465-99129487 CTCTGTAGGCCTCTATTGGCAGG + Intergenic
995301100 5:110584029-110584051 CCCTGCAGTACACTACTGGTAGG + Intronic
1000927113 5:167207352-167207374 CCCTGAAGGCAACAATTGGCCGG - Intergenic
1001184476 5:169555429-169555451 CCCAGAATGCCCCTACTGGTTGG + Intergenic
1004333236 6:14740610-14740632 CCCTGGGGGTCACTGCTGGCTGG - Intergenic
1008795690 6:55299825-55299847 ACATGAAGGCCAGTATTGGCAGG - Intergenic
1009596526 6:65744641-65744663 GCCTGAAGGCCATTGCTGGTAGG - Intergenic
1011129777 6:84041309-84041331 CCCTGCAGCACACTTCTGGCTGG - Intronic
1016927251 6:149363037-149363059 CCCTGAATACCACTACAGGAAGG + Intronic
1019388632 7:773048-773070 CCCTGAAGGCCAGGACTTCCAGG + Intronic
1019510380 7:1414681-1414703 CCCTGAAGACCACAGCAGGCTGG + Intergenic
1019634864 7:2070129-2070151 CCCTGAGGCCCGCTACTGCCAGG - Intronic
1026945371 7:74312734-74312756 CCCTGAGGGCCAGGGCTGGCAGG + Intronic
1029222138 7:98998982-98999004 CCCTGCAGGCCCCCACAGGCGGG + Intronic
1031743610 7:125467248-125467270 AGCTGAGGGCCACTACTGACAGG + Intergenic
1032721398 7:134553243-134553265 CCCTGTACACCACTACTGGAGGG + Intronic
1034670140 7:152851626-152851648 CCCTGGAGGGCAGTGCTGGCTGG + Intronic
1036527292 8:9547093-9547115 CCCTGAAGGCCATTAGTGAAGGG - Intergenic
1036644307 8:10602264-10602286 CCCAGGAGGCCAGTCCTGGCTGG + Intergenic
1038930052 8:32183632-32183654 ACCTGAAGGCTATTAGTGGCTGG - Intronic
1042704676 8:71653591-71653613 CCCTGGAGCCCACTGCAGGCAGG - Intergenic
1056656021 9:88509717-88509739 CCCTGGAGGGCTCTGCTGGCTGG + Intergenic
1058956248 9:109951515-109951537 GCCTGAAGTCCGCTAGTGGCAGG - Intronic
1059233786 9:112745160-112745182 CCCTGAAGGCTCCTAGTAGCTGG - Intergenic
1203482524 Un_GL000224v1:20022-20044 CCCAGAAGGACTCTATTGGCTGG + Intergenic
1203710142 Un_KI270742v1:90296-90318 CCCAGAAGGACTCTAGTGGCTGG - Intergenic
1203540908 Un_KI270743v1:87155-87177 CCCAGAAGGACTCTAGTGGCTGG + Intergenic
1186476571 X:9862404-9862426 CGCTGAGGGCCACCGCTGGCTGG + Intronic
1188190280 X:27164288-27164310 CCCCTAAGCCCACCACTGGCAGG + Intergenic
1190502904 X:51097026-51097048 GCTGGAAGGCCACTTCTGGCAGG - Intergenic
1195178868 X:102338027-102338049 CCCTTAAGGAAACAACTGGCTGG - Intergenic
1195179996 X:102349056-102349078 CCCTTAAGGAAACAACTGGCTGG + Intergenic
1196141160 X:112265096-112265118 CCAAGAGGGCCACTACTGGGTGG - Intergenic
1198158727 X:133986278-133986300 CCCTGAACGCGACTATTTGCAGG - Intergenic
1199522660 X:148753838-148753860 CCATGAAAGCCACTACTACCTGG + Intronic
1199580791 X:149358053-149358075 CCCTGCAGGAAACTACTGCCTGG - Intergenic
1200459730 Y:3440649-3440671 CCCTGAAGCCGACTTCTGCCTGG + Intergenic
1201165123 Y:11201948-11201970 CCCAGAAGGACTCTAGTGGCTGG - Intergenic