ID: 1125606846

View in Genome Browser
Species Human (GRCh38)
Location 15:40944315-40944337
Sequence GAGAAGTCAAGGTGCTCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125606846_1125606849 -2 Left 1125606846 15:40944315-40944337 CCTTGTGAGCACCTTGACTTCTC No data
Right 1125606849 15:40944336-40944358 TCCACAATGTAGGTTTTCTGAGG No data
1125606846_1125606851 17 Left 1125606846 15:40944315-40944337 CCTTGTGAGCACCTTGACTTCTC No data
Right 1125606851 15:40944355-40944377 GAGGCTTCTCTTCTAGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125606846 Original CRISPR GAGAAGTCAAGGTGCTCACA AGG (reversed) Intergenic
No off target data available for this crispr