ID: 1125607078

View in Genome Browser
Species Human (GRCh38)
Location 15:40945693-40945715
Sequence CTTTGGAAGGCCAAGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125607070_1125607078 11 Left 1125607070 15:40945659-40945681 CCGGATGCAGTGGCTCACACCTG 0: 369
1: 6705
2: 26125
3: 68673
4: 122545
Right 1125607078 15:40945693-40945715 CTTTGGAAGGCCAAGGTGGACGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
1125607072_1125607078 -8 Left 1125607072 15:40945678-40945700 CCTGTAATCCCATCACTTTGGAA 0: 64
1: 12204
2: 325174
3: 262869
4: 138851
Right 1125607078 15:40945693-40945715 CTTTGGAAGGCCAAGGTGGACGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125607078 Original CRISPR CTTTGGAAGGCCAAGGTGGA CGG Intergenic
Too many off-targets to display for this crispr