ID: 1125609248

View in Genome Browser
Species Human (GRCh38)
Location 15:40959752-40959774
Sequence GCTCCTGGAGAGCCAGGAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125609244_1125609248 -1 Left 1125609244 15:40959730-40959752 CCTATCTGTGCCTCTAGGGCATG No data
Right 1125609248 15:40959752-40959774 GCTCCTGGAGAGCCAGGAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125609248 Original CRISPR GCTCCTGGAGAGCCAGGAGT CGG Intergenic
No off target data available for this crispr