ID: 1125609249

View in Genome Browser
Species Human (GRCh38)
Location 15:40959755-40959777
Sequence CCACCGACTCCTGGCTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125609249_1125609256 26 Left 1125609249 15:40959755-40959777 CCTGGAGAGCCAGGAGTCGGTGG No data
Right 1125609256 15:40959804-40959826 TATTGAATCTACAACAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125609249 Original CRISPR CCACCGACTCCTGGCTCTCC AGG (reversed) Intergenic