ID: 1125609256

View in Genome Browser
Species Human (GRCh38)
Location 15:40959804-40959826
Sequence TATTGAATCTACAACAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125609255_1125609256 -7 Left 1125609255 15:40959788-40959810 CCGATTCATTGCTTTTTATTGAA No data
Right 1125609256 15:40959804-40959826 TATTGAATCTACAACAGCCCAGG No data
1125609253_1125609256 17 Left 1125609253 15:40959764-40959786 CCAGGAGTCGGTGGGAAGGATCG No data
Right 1125609256 15:40959804-40959826 TATTGAATCTACAACAGCCCAGG No data
1125609249_1125609256 26 Left 1125609249 15:40959755-40959777 CCTGGAGAGCCAGGAGTCGGTGG No data
Right 1125609256 15:40959804-40959826 TATTGAATCTACAACAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125609256 Original CRISPR TATTGAATCTACAACAGCCC AGG Intergenic