ID: 1125612590

View in Genome Browser
Species Human (GRCh38)
Location 15:40981934-40981956
Sequence AGGGAGGAGAAGAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3104
Summary {0: 1, 1: 2, 2: 27, 3: 320, 4: 2754}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125612590_1125612593 -7 Left 1125612590 15:40981934-40981956 CCTTCCTCATTCTTCTCCTCCCT 0: 1
1: 2
2: 27
3: 320
4: 2754
Right 1125612593 15:40981950-40981972 CCTCCCTTTTGAATACAGACAGG 0: 1
1: 0
2: 0
3: 17
4: 160
1125612590_1125612596 8 Left 1125612590 15:40981934-40981956 CCTTCCTCATTCTTCTCCTCCCT 0: 1
1: 2
2: 27
3: 320
4: 2754
Right 1125612596 15:40981965-40981987 CAGACAGGCAACTTATCAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 110
1125612590_1125612597 15 Left 1125612590 15:40981934-40981956 CCTTCCTCATTCTTCTCCTCCCT 0: 1
1: 2
2: 27
3: 320
4: 2754
Right 1125612597 15:40981972-40981994 GCAACTTATCAGCAGGACCATGG 0: 1
1: 0
2: 0
3: 3
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125612590 Original CRISPR AGGGAGGAGAAGAATGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr