ID: 1125612593

View in Genome Browser
Species Human (GRCh38)
Location 15:40981950-40981972
Sequence CCTCCCTTTTGAATACAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 160}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125612589_1125612593 -1 Left 1125612589 15:40981928-40981950 CCAAATCCTTCCTCATTCTTCTC 0: 1
1: 0
2: 10
3: 89
4: 749
Right 1125612593 15:40981950-40981972 CCTCCCTTTTGAATACAGACAGG 0: 1
1: 0
2: 0
3: 17
4: 160
1125612587_1125612593 18 Left 1125612587 15:40981909-40981931 CCAGCTCTCTGTCACCAGTCCAA 0: 1
1: 0
2: 2
3: 12
4: 201
Right 1125612593 15:40981950-40981972 CCTCCCTTTTGAATACAGACAGG 0: 1
1: 0
2: 0
3: 17
4: 160
1125612590_1125612593 -7 Left 1125612590 15:40981934-40981956 CCTTCCTCATTCTTCTCCTCCCT 0: 1
1: 2
2: 27
3: 320
4: 2754
Right 1125612593 15:40981950-40981972 CCTCCCTTTTGAATACAGACAGG 0: 1
1: 0
2: 0
3: 17
4: 160
1125612585_1125612593 30 Left 1125612585 15:40981897-40981919 CCTTGGCCACTGCCAGCTCTCTG 0: 1
1: 1
2: 5
3: 86
4: 501
Right 1125612593 15:40981950-40981972 CCTCCCTTTTGAATACAGACAGG 0: 1
1: 0
2: 0
3: 17
4: 160
1125612586_1125612593 24 Left 1125612586 15:40981903-40981925 CCACTGCCAGCTCTCTGTCACCA 0: 1
1: 0
2: 5
3: 31
4: 402
Right 1125612593 15:40981950-40981972 CCTCCCTTTTGAATACAGACAGG 0: 1
1: 0
2: 0
3: 17
4: 160
1125612588_1125612593 4 Left 1125612588 15:40981923-40981945 CCAGTCCAAATCCTTCCTCATTC 0: 1
1: 0
2: 5
3: 32
4: 319
Right 1125612593 15:40981950-40981972 CCTCCCTTTTGAATACAGACAGG 0: 1
1: 0
2: 0
3: 17
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125612593 Original CRISPR CCTCCCTTTTGAATACAGAC AGG Intronic
903736080 1:25530640-25530662 CCTCCTCTTTGAACAGAGACTGG + Intergenic
903811836 1:26038979-26039001 CCTCCCATCTGACTACAGCCAGG - Exonic
904511652 1:31015121-31015143 CTTCCCTTTTGGATCAAGACTGG + Intronic
904823729 1:33261351-33261373 CCTCCCTTGTGAATAACGCCTGG + Intronic
906728852 1:48064197-48064219 CCTCCCTCATGAAGACAGATCGG + Intergenic
907518754 1:55009619-55009641 CCTGCTTTGTGAATACATACAGG - Exonic
907704749 1:56822997-56823019 TCTCCCTTTTGAAAGCAGTCAGG - Intergenic
909919255 1:81360056-81360078 CTTCCCATTTGAATGGAGACTGG + Intronic
913576728 1:120182750-120182772 ACTCCATCTTGAATACAGGCTGG - Intergenic
914172096 1:145234338-145234360 CCTGCCCTTTGAAATCAGACTGG + Intergenic
916904701 1:169269940-169269962 TCTCTCTTTTTAATATAGACAGG + Intronic
921831267 1:219730456-219730478 ACTCCATCTTGAATAGAGACTGG + Intronic
1062859988 10:803501-803523 CCTCCCTTCTGTGCACAGACAGG - Intergenic
1068195745 10:53713865-53713887 CCTCTCTTTGGAAAACACACAGG + Intergenic
1068601659 10:58963598-58963620 CCTCCCTCTTGGGTACAGATGGG + Intergenic
1068842234 10:61628643-61628665 CCTCCTTTCTGAAGACAGACTGG + Intergenic
1069092636 10:64220117-64220139 CCTTCCTTCTAAATATAGACTGG - Intergenic
1073508245 10:104022201-104022223 CCTCCCTAATGACTACACACTGG - Intronic
1075068853 10:119307778-119307800 CCTCCTTTCTGCATACACACTGG + Intronic
1078703737 11:13717547-13717569 CCTTCCTTTTGCATAAAAACTGG + Intronic
1079281228 11:19088948-19088970 ACTCCATTTTGAATAGAGACTGG - Intergenic
1079363640 11:19790797-19790819 CCCCCCTTTTGCAAACAGAAAGG - Intronic
1080812860 11:35722817-35722839 ACTCCATTTTGAATACAGGCTGG - Intronic
1083153020 11:60805336-60805358 CCTCCCTTCTGCAAACAGAGTGG - Intergenic
1085130287 11:74032446-74032468 CCTTCCTTTTAAACACAGACTGG - Intronic
1086232599 11:84588574-84588596 GCTCCATTTTGAATACAGGCTGG + Intronic
1088363988 11:109019771-109019793 CTTCCCTCTTGCATACAGGCAGG - Intergenic
1090109714 11:123893555-123893577 TCACATTTTTGAATACAGACAGG + Intergenic
1091907301 12:4199550-4199572 CCTCCCTTTTGCAGATAGACAGG + Intergenic
1093067974 12:14678704-14678726 CCTCTTGTCTGAATACAGACAGG + Intronic
1095178836 12:39123721-39123743 ACTCCATCTTGAATAGAGACTGG + Intergenic
1095306912 12:40650015-40650037 CCTGCCTGCTGAATAAAGACAGG + Intergenic
1096886482 12:54724012-54724034 CCTCCATCTTGAATAGGGACGGG - Intergenic
1098851588 12:75602340-75602362 CCTCCCTTGGGAATGCAGATGGG - Intergenic
1099134243 12:78874910-78874932 CCTCACTTTTTAATGCAGAAGGG + Intronic
1100084683 12:90894964-90894986 CCTGCCTTCTAAATACAGAGAGG + Intergenic
1101256355 12:102981125-102981147 ACTCCCTTTGGAATAAAGATAGG - Intergenic
1104584569 12:130037646-130037668 ACTCCCTTTTGAATAGGGGCTGG - Intergenic
1105919920 13:24953715-24953737 CATCCCTTTTAAATATAAACTGG + Intergenic
1108001577 13:45909855-45909877 CCTCCCTGTTGCAGACAGGCTGG - Intergenic
1108748253 13:53418154-53418176 ACTCCCTAGTGAATAAAGACTGG - Intergenic
1111462567 13:88565852-88565874 CCTCCTATTTCAAAACAGACTGG - Intergenic
1119104302 14:71909654-71909676 GCTCCTTCTTGAATAGAGACTGG - Intergenic
1121916318 14:97839530-97839552 CCTCCCTCTTGAGCACAAACAGG - Intergenic
1121940204 14:98063250-98063272 CTTCCCTGCAGAATACAGACAGG - Intergenic
1122248479 14:100421322-100421344 CCTCCCTTTGCAAGACTGACTGG - Intronic
1122257159 14:100486833-100486855 CTTCCCTTTTAAATACAGTAGGG + Intronic
1125612593 15:40981950-40981972 CCTCCCTTTTGAATACAGACAGG + Intronic
1130141548 15:81230282-81230304 CTTCCCATTTGCAAACAGACAGG - Intronic
1131220553 15:90580343-90580365 CCCCACTTTTGCCTACAGACAGG - Intronic
1133609470 16:7419396-7419418 CCTCGCTTGTGAATGCAGAGGGG + Intronic
1133974269 16:10589263-10589285 CTTCCCTTTGGAAGCCAGACGGG - Intergenic
1134350786 16:13436101-13436123 ACTCCGTCTTGAATACAGACTGG + Intergenic
1135394082 16:22117664-22117686 CCTCCCTTGTGAACACAGGGTGG - Intronic
1137515895 16:49143900-49143922 TTTCCCTTTTGAACACAGTCTGG - Intergenic
1138605777 16:58087653-58087675 CCTCGCATTTGAACACACACAGG + Intergenic
1139720437 16:68848099-68848121 TCTCTCTTTTAAATAGAGACAGG + Intronic
1139901894 16:70334642-70334664 ACTGCCTTTGGAATACAAACAGG + Exonic
1140196101 16:72856854-72856876 CCTGGCTTATAAATACAGACAGG + Intronic
1140692911 16:77501470-77501492 CCTCTCATTTGAAAACACACAGG + Intergenic
1148373041 17:47115319-47115341 TCTCTTTTTTTAATACAGACGGG + Intergenic
1149282136 17:55118538-55118560 CCTTTCTTTTGACTCCAGACTGG - Intronic
1150348736 17:64424961-64424983 ACTCCCTCTTGAATAGGGACTGG - Intergenic
1153134198 18:1894964-1894986 CCTGCCTTGTGAACACAGGCTGG + Intergenic
1154257635 18:12797852-12797874 CCTCCCTTAAGACTACAGGCAGG + Intronic
1156921873 18:42531896-42531918 CTTTCCTTTTTAATAGAGACAGG - Intergenic
1157512294 18:48285209-48285231 CATACCTTTTGTAAACAGACAGG - Intronic
1158846970 18:61454416-61454438 CCTCCCTTTTCATTCCAGACAGG - Intronic
1162111245 19:8400895-8400917 CCTCTTTTTTGGAGACAGACAGG + Intronic
1162815060 19:13188935-13188957 CCTCTATTTTTAATAGAGACGGG + Intergenic
1165643116 19:37407168-37407190 CCTCTCTTTTAAATAGAAACAGG + Intergenic
1166936806 19:46338875-46338897 ACTGCCGTTTGAATCCAGACAGG + Intronic
925627162 2:5852857-5852879 CCTCCCTGTACAATACAGGCGGG + Intergenic
925892606 2:8448009-8448031 ACTCCATCTTGAATACAGGCTGG + Intergenic
933087412 2:78073253-78073275 CCTCTCTTTTAAATACAGTGAGG - Intergenic
934978211 2:98821191-98821213 TCTCTCTTTTTAAAACAGACAGG + Intronic
937197520 2:120172795-120172817 CCTCCTTTTTGAATCTGGACAGG - Intronic
938158349 2:128960206-128960228 CCTACCTTATGAATAGAGGCTGG - Intergenic
939526977 2:143307320-143307342 CCTCTCTTTTCACTACAGACAGG - Intronic
942859538 2:180592535-180592557 CTTCTCTTTTGAAAACAGTCTGG + Intergenic
943815679 2:192251065-192251087 ACTCCATTTTGAATACAAAGTGG - Intergenic
945296878 2:208179432-208179454 CCTCCCTTCTGAATCCAGGTGGG + Intronic
945840617 2:214883630-214883652 CCCCCATTTCCAATACAGACCGG - Intergenic
948158815 2:235807481-235807503 GATCCCATTTGAATACACACAGG - Intronic
1168958469 20:1851240-1851262 CTTCTCTTTTCATTACAGACTGG + Intergenic
1170625324 20:18025883-18025905 CCTGCCTTGTGCAGACAGACTGG + Intronic
1172452141 20:35033817-35033839 TCTCTTTTTTGAATAGAGACGGG - Intronic
1175444766 20:59012422-59012444 ACTCCATCTTGAATACAGACTGG - Intergenic
1175746829 20:61462867-61462889 CATCCCCTTTGAAGACTGACGGG - Intronic
1179381201 21:40900973-40900995 CCTGCATTTTGAATGCAGTCAGG - Intergenic
1181519862 22:23439775-23439797 ACTCCATTTTGAATAAGGACTGG + Intergenic
1183852298 22:40600547-40600569 TCTCCCTTTTTAATATATACAGG - Intronic
949793110 3:7815141-7815163 CCTTCCTTTTGAATATGGGCTGG + Intergenic
953258503 3:41313795-41313817 CCCTCATTTTGAATACAGACCGG + Intronic
953270252 3:41435644-41435666 ACTACCTTAAGAATACAGACAGG + Intronic
953844039 3:46412739-46412761 CATCCTTTTTTAATATAGACTGG - Intronic
954173145 3:48821614-48821636 ACTCCCTTTTGAATGGAAACAGG + Intronic
955969434 3:64422997-64423019 CCTCCCATTTAAATATAGTCTGG + Intronic
957657060 3:83093906-83093928 CCTCTTTTTTAAATAGAGACAGG - Intergenic
965692548 3:171372837-171372859 CTTCTCTTTTGATTCCAGACTGG - Intronic
965966368 3:174495285-174495307 CCTCCCTTATGAATGCAGTAAGG - Intronic
968080717 3:195844702-195844724 CCTCCTTTTTTAGTAGAGACGGG - Intergenic
968990459 4:3907951-3907973 TCTCCCTTTTTCACACAGACTGG + Intergenic
969517850 4:7658458-7658480 GCTCTCTCCTGAATACAGACAGG - Intronic
972078449 4:35117183-35117205 CCTCCATTTTGTAAATAGACAGG + Intergenic
974029009 4:56759165-56759187 ACTCCATTTTGAATAGAGACTGG + Intergenic
977661616 4:99594281-99594303 CCTACCTTTTGATGACAGACAGG + Intronic
977919195 4:102625011-102625033 CCTGTCTTTTGGTTACAGACAGG - Intergenic
981019531 4:140010929-140010951 GCTACTTTTTGAATAGAGACGGG - Intronic
982003183 4:151039616-151039638 CTTCCCTTTTGAATCCATAAGGG + Intergenic
982546356 4:156737943-156737965 CCTCTCTTCTGAGTACAGGCTGG + Intergenic
983327793 4:166281140-166281162 CCTCCCTTCTGAATGCAGCAGGG + Intergenic
985689447 5:1299068-1299090 CCTCCCTCTGGAACACAGAGTGG - Intergenic
987728332 5:21733297-21733319 CTTCCATTTAGAATACAGTCTGG - Intergenic
988835097 5:35024463-35024485 AATCCCTTTTGAAAACACACAGG + Intronic
989130194 5:38099630-38099652 ACTCCATCTTGAATAGAGACTGG + Intergenic
990171943 5:53061223-53061245 CCTCCCTTTTGACAACTTACTGG + Intronic
991297507 5:65097022-65097044 CCTCCCTTGTTTGTACAGACAGG - Intergenic
993681093 5:90879092-90879114 CCTTCCTTTTGCATGCAGACTGG - Intronic
994296961 5:98101809-98101831 GCTTCATTTTTAATACAGACAGG - Intergenic
996278695 5:121700269-121700291 TCTCCCTTTATAATAAAGACAGG - Intergenic
1004692359 6:18003521-18003543 CCTCTATTTTTAATAGAGACGGG - Intergenic
1005444264 6:25905055-25905077 CCTCTCTTATGAACATAGACAGG - Intergenic
1005615486 6:27568527-27568549 ACTCCCTCTTGAATACCGGCTGG + Intergenic
1006937803 6:37730507-37730529 CCTCCCTTTTGGCCACAGCCTGG - Intergenic
1007246973 6:40470012-40470034 CCTTCCTTTTGAATTCCCACTGG + Intronic
1008064312 6:47031201-47031223 TCTCCCATTTGGAAACAGACTGG - Intronic
1011729048 6:90241590-90241612 CCTTGCTTTTGACAACAGACAGG - Intronic
1014002527 6:116380754-116380776 AATCCCTTTTGGATACAGAGAGG + Intronic
1014231874 6:118912974-118912996 TTTTCCTTTTGAAAACAGACCGG + Intronic
1015342535 6:132118193-132118215 CCTATCTTTTCAATACACACTGG + Intergenic
1016361044 6:143267774-143267796 CCTCCCTCATGAACAGAGACTGG - Intronic
1018033830 6:159865457-159865479 CCTCCCTTCTGACTCCTGACTGG + Intergenic
1018999439 6:168736607-168736629 GCTCCATTTTGAATACAGCCTGG + Intergenic
1019591397 7:1836507-1836529 ACTCCATTTTGAATAAGGACTGG - Intronic
1020528460 7:9295926-9295948 ACTCCATCTTGAATAAAGACTGG + Intergenic
1022657293 7:32331157-32331179 CCTTCCTTTTAAATACAAACAGG + Intergenic
1024433814 7:49324510-49324532 ACTCCATTTTGAATAGCGACTGG - Intergenic
1024682262 7:51704741-51704763 CCTCACAGTTGAACACAGACAGG - Intergenic
1025019792 7:55472013-55472035 CCTGCCCTTTGAAATCAGACTGG - Exonic
1025995227 7:66523529-66523551 CCTCCCTCCTGAACCCAGACTGG - Intergenic
1026618369 7:71928100-71928122 CCTCCATATTGAAGACAGAGAGG - Intronic
1026986872 7:74560217-74560239 CCTCCCTCCTGAACCCAGACTGG - Intronic
1028806462 7:95031978-95032000 CATCACTTCTGAATACAGATAGG - Intronic
1028990630 7:97045491-97045513 TCTACTTTTTGAATCCAGACAGG + Intergenic
1032006435 7:128305674-128305696 CCCGCCTTGTGCATACAGACTGG + Exonic
1032086985 7:128889512-128889534 CCTCCCTTTTTAAAAAAGAAGGG + Intronic
1032171034 7:129584773-129584795 CTTCCTTTTTGAAGGCAGACAGG - Intergenic
1032200370 7:129817897-129817919 TCTTCCTTTTAAATATAGACAGG + Intergenic
1032488505 7:132306247-132306269 TCTCCCTTTTGCAAACTGACTGG - Intronic
1036753714 8:11458737-11458759 ATTCCCTTTTTACTACAGACGGG - Intronic
1039123236 8:34172160-34172182 CCTACCTTTTTAAGACAGAATGG + Intergenic
1039144861 8:34436328-34436350 CCTAACTTTTTAATAGAGACGGG + Intergenic
1041320011 8:56603206-56603228 GCTCCCTGGTGAATACAGAATGG + Intergenic
1041394295 8:57375550-57375572 CCTCTCTTTTGACTACTGAATGG + Intergenic
1043076593 8:75708857-75708879 CTCCCCTTTTTAATACAGAATGG + Intergenic
1044496021 8:92884198-92884220 CCACACTTTTGAATACCTACTGG - Exonic
1046758511 8:117996055-117996077 CCTTGCCTTTGAATCCAGACAGG + Intronic
1047233776 8:123020556-123020578 CCTCCCTTTAAAATTCTGACTGG + Intronic
1047584449 8:126254569-126254591 CCTTCCCTTTGAGTACAGGCTGG - Intergenic
1047995850 8:130335076-130335098 CCTCCCTTCAGAGTTCAGACTGG + Intronic
1049943743 9:574513-574535 CCTCCCTGTTGAGAACAGAGTGG - Intronic
1050746197 9:8879106-8879128 CCTCTCTCTGGAATACAGAAAGG - Intronic
1056681387 9:88722033-88722055 ACTCCATCTTGAATACAGGCTGG - Intergenic
1059242708 9:112821099-112821121 CATCACTTTTGAAAACAGTCTGG - Intronic
1059262230 9:112988815-112988837 CTTGCCTTTTTAATACTGACTGG + Intergenic
1059655750 9:116355724-116355746 CCTCTCCTTTAAATACAAACTGG - Intronic
1061730304 9:132609032-132609054 CCTGCCTTTCGAAGGCAGACGGG - Intronic
1186806021 X:13140512-13140534 CCTCCTGCTTGAATACAGAAGGG + Intergenic
1188045026 X:25415767-25415789 CCACAATTTTGCATACAGACAGG + Intergenic
1189374038 X:40452621-40452643 TCTCCCTTTTCAATTGAGACAGG + Intergenic
1190507694 X:51143471-51143493 CTCCCCTTTTGAAGACAGAAAGG - Intergenic
1192732527 X:73815552-73815574 CTTCCCTTTAAAATACAGTCTGG - Intergenic
1193689302 X:84621148-84621170 AGTCACTTTTGAAGACAGACTGG - Intergenic
1198680002 X:139171080-139171102 CCTCCCTTCTGAATTCCCACAGG + Intronic
1198684075 X:139209295-139209317 CCTCCCTTCTTGATACTGACTGG + Intronic
1199462887 X:148103068-148103090 ACTCCCTTTTGAAGACACACAGG + Intergenic
1199724042 X:150564859-150564881 GCTGCTTTTTAAATACAGACTGG + Intergenic