ID: 1125612596

View in Genome Browser
Species Human (GRCh38)
Location 15:40981965-40981987
Sequence CAGACAGGCAACTTATCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 110}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125612588_1125612596 19 Left 1125612588 15:40981923-40981945 CCAGTCCAAATCCTTCCTCATTC 0: 1
1: 0
2: 5
3: 32
4: 319
Right 1125612596 15:40981965-40981987 CAGACAGGCAACTTATCAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 110
1125612589_1125612596 14 Left 1125612589 15:40981928-40981950 CCAAATCCTTCCTCATTCTTCTC 0: 1
1: 0
2: 10
3: 89
4: 749
Right 1125612596 15:40981965-40981987 CAGACAGGCAACTTATCAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 110
1125612592_1125612596 -8 Left 1125612592 15:40981950-40981972 CCTCCCTTTTGAATACAGACAGG 0: 1
1: 0
2: 0
3: 13
4: 161
Right 1125612596 15:40981965-40981987 CAGACAGGCAACTTATCAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 110
1125612591_1125612596 4 Left 1125612591 15:40981938-40981960 CCTCATTCTTCTCCTCCCTTTTG 0: 1
1: 0
2: 6
3: 104
4: 916
Right 1125612596 15:40981965-40981987 CAGACAGGCAACTTATCAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 110
1125612590_1125612596 8 Left 1125612590 15:40981934-40981956 CCTTCCTCATTCTTCTCCTCCCT 0: 1
1: 2
2: 27
3: 320
4: 2754
Right 1125612596 15:40981965-40981987 CAGACAGGCAACTTATCAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125612596 Original CRISPR CAGACAGGCAACTTATCAGC AGG Intronic
904129321 1:28263774-28263796 CAGATTGGCTACTTGTCAGCTGG + Intronic
906397000 1:45475006-45475028 CAGAAAGGCAACTCATGGGCTGG + Intronic
907415278 1:54310147-54310169 AAGACGGGCATCTTGTCAGCCGG - Intronic
909457019 1:75861511-75861533 CAGACAGGCCACTCAGCTGCAGG + Intronic
911544631 1:99202066-99202088 CAGACAAGCTACTTACCAGGCGG - Intergenic
913975579 1:143451953-143451975 CACAAATGCAACTTGTCAGCTGG - Intergenic
914069973 1:144277570-144277592 CACAAATGCAACTTGTCAGCTGG - Intergenic
914109182 1:144688784-144688806 CACAAATGCAACTTGTCAGCTGG + Intergenic
915328613 1:155094327-155094349 CAGACAGGCAGCCCTTCAGCAGG - Intergenic
916198083 1:162243756-162243778 CAGACAGCCAACATCTCAGATGG - Intronic
920746693 1:208635681-208635703 CAGACAAGCTGCTCATCAGCAGG - Intergenic
920819314 1:209365538-209365560 CAGGCAGCCCACTTGTCAGCTGG - Intergenic
922618251 1:226976032-226976054 CAGCCAGGCAACATCGCAGCAGG - Intronic
1072807944 10:98436840-98436862 AAGACAGGCAACTGGCCAGCGGG + Intronic
1088562546 11:111130399-111130421 TTGACAGGCAACTCATCAGGCGG - Intergenic
1090272868 11:125400112-125400134 CAGAAAGGCCATTGATCAGCTGG + Intronic
1094527991 12:31245663-31245685 CAAACAGACATCTTAACAGCAGG - Intergenic
1095257028 12:40050799-40050821 CAGCCTTGCCACTTATCAGCTGG + Intronic
1098387004 12:69930255-69930277 CAGCCAGGCTTCTTACCAGCTGG - Intronic
1099440749 12:82696798-82696820 CAGGGAGGCAAGTTATCAGAGGG - Intronic
1102249987 12:111380245-111380267 CAGACAAGAAACTTCTCAGGCGG - Intergenic
1103744228 12:123111311-123111333 CAGAGAGGCTGCTTATCTGCTGG + Intronic
1104680991 12:130751817-130751839 CAGACGGGAAAGTTATCAGGGGG - Intergenic
1111583742 13:90257968-90257990 CAGTCATGCAAATTTTCAGCAGG - Intergenic
1111585306 13:90276317-90276339 CAGACAGGCAAAGAAACAGCTGG - Intergenic
1113053325 13:106238788-106238810 CAGACAGGCAGCTTTTCAAATGG - Intergenic
1113610002 13:111637905-111637927 CTGACATGCAACTTCTCAGGAGG + Intronic
1113610017 13:111637963-111637985 CTGACATGCAACTTCTCAGGAGG + Intronic
1113931262 13:113970155-113970177 CGGACAGGCTGCTTACCAGCTGG + Intergenic
1119425663 14:74533374-74533396 CAGACAGGAAACAGATCAGGGGG + Intronic
1122648597 14:103211820-103211842 TAGAAATGCAACTGATCAGCTGG + Intergenic
1124948324 15:34292234-34292256 CAGACAGGCCACTCAGCTGCAGG + Intronic
1125612596 15:40981965-40981987 CAGACAGGCAACTTATCAGCAGG + Intronic
1129460808 15:75699326-75699348 CAGAAAGGCAACTAAACAGAAGG - Intronic
1129712319 15:77826640-77826662 CTGACCTGCCACTTATCAGCTGG - Intergenic
1129724005 15:77892391-77892413 CAGAAAGGCAACTAAACAGAAGG + Intergenic
1131454659 15:92573965-92573987 CAGACTGGCAACATATCAGGAGG + Intergenic
1132323047 15:100941521-100941543 CAGGCAGGCCACCGATCAGCAGG - Intronic
1138426353 16:56935006-56935028 CAGAATGGCAAATTATCGGCTGG - Intronic
1140721194 16:77773771-77773793 CAGACAGGCATGATTTCAGCTGG + Intergenic
1144300851 17:13922161-13922183 GAGACAGGCCACTCAGCAGCTGG - Intergenic
1149076349 17:52599867-52599889 CAGACTGGCAACTGTTCACCAGG - Intergenic
1149191855 17:54072647-54072669 CAGACAAGCACCTCATCTGCAGG + Intergenic
1150010000 17:61494612-61494634 CAGACAGGCAAATTATGTGGGGG - Intergenic
1152658353 17:81530356-81530378 CAGACAGGCAACTGGTGACCTGG - Intronic
1156276774 18:35591256-35591278 AACACTGGCAGCTTATCAGCTGG + Intronic
1157193242 18:45598653-45598675 CAGAAAGCCAACTTATCCACTGG - Intronic
1162220363 19:9171224-9171246 CAAAGAGTCAACTTACCAGCTGG + Intergenic
1163520975 19:17791568-17791590 CAATTAGGCCACTTATCAGCTGG - Intergenic
1165269169 19:34690044-34690066 CAGACAGTGACCCTATCAGCAGG + Intergenic
1166002564 19:39886405-39886427 CACACAGGCCACACATCAGCTGG + Exonic
1166005349 19:39902657-39902679 CACACAGGCCACACATCAGCTGG + Exonic
925147781 2:1592376-1592398 CAGACCAGAAACTTATCAGGGGG + Intergenic
929262028 2:39876472-39876494 CAGATATGCTACTTATTAGCTGG + Intergenic
930421125 2:51153769-51153791 CAGACAGGCAACTCAGCATTAGG + Intergenic
930858891 2:56049291-56049313 CAGAGAGTCAAATTATCAACAGG - Intergenic
932005429 2:67922463-67922485 CAGAAAAGCAGCTCATCAGCCGG - Intergenic
932747277 2:74344377-74344399 CAGATAGGAAATTTATCATCTGG + Intronic
933812981 2:86044586-86044608 CAGACAGTCATCTCAGCAGCTGG - Intronic
934180277 2:89612925-89612947 CACAAATGCAACTTGTCAGCTGG - Intergenic
934290577 2:91687188-91687210 CACAAATGCAACTTGTCAGCTGG - Intergenic
941000959 2:160203570-160203592 CAGACAGGCAACTCAAGACCTGG - Intronic
948283749 2:236768689-236768711 GAGTCAGGCCACTGATCAGCAGG + Intergenic
1170232851 20:14069474-14069496 CAGACAGGCAACATAACTGAGGG - Intronic
1171308716 20:24128199-24128221 CAGACAAGGAACTAATCACCGGG + Intergenic
1171366715 20:24629916-24629938 CAGAAAGGCCACTTGGCAGCAGG - Intronic
1171484706 20:25478351-25478373 CAGACAGGCTGCTGCTCAGCTGG - Intronic
1173760094 20:45552383-45552405 CAGACAGGAATCCTATCAGATGG - Intronic
1178712773 21:34934054-34934076 AAGGCAAGCAACTTATCTGCTGG - Intronic
1179481734 21:41682732-41682754 CAGACAGGCGGATTATCAGAAGG + Intergenic
1181508057 22:23375010-23375032 CAGCCTGGCCACTTATCATCTGG + Intergenic
1181799172 22:25333142-25333164 CAGACAGGACACAAATCAGCAGG + Intergenic
1182642907 22:31782638-31782660 TAGACTGGCAACTCATCACCTGG + Intronic
949363021 3:3251984-3252006 GAGACAGGAAGCCTATCAGCAGG - Intergenic
949440242 3:4072187-4072209 CAGTCAGGCCACTTAGCTGCAGG - Intronic
950645081 3:14372270-14372292 CAGCCAGGCATATTACCAGCAGG + Intergenic
951370812 3:21845166-21845188 CAGACATGCAACCTATAATCTGG - Intronic
953471860 3:43174182-43174204 CAGGCAGGAAACTCATCAGGTGG + Intergenic
954579815 3:51697145-51697167 CAGCCAGGCAACTTCAGAGCCGG + Intronic
954922482 3:54203697-54203719 CAGGCAGGCCACTGACCAGCGGG - Intronic
956288383 3:67635351-67635373 GAGACAGGCAACTGAACAGTGGG + Intronic
956321110 3:67997429-67997451 CAGAGAGGCAATCTAACAGCAGG - Intergenic
959529127 3:107412485-107412507 TAGACAGGCAATTTAACAGAGGG - Intergenic
963344107 3:144072911-144072933 CAGACAGCCAACTTAAAAACTGG - Intergenic
964211086 3:154228908-154228930 CAGTCAAGGAACTTAGCAGCTGG + Intronic
969829003 4:9780712-9780734 CACAAATGCAACTTGTCAGCTGG + Intronic
970201557 4:13613349-13613371 CAGACAGACAACTTTGGAGCTGG + Intronic
970403324 4:15738634-15738656 CAAACAGGTAAGCTATCAGCTGG - Intergenic
990278815 5:54228092-54228114 CAGAAATGCAAATTATCAGATGG + Intronic
991456880 5:66813487-66813509 AAGAAAGGCAACTGAACAGCTGG - Intronic
993337602 5:86680407-86680429 CAGACACACAATTTATCAGTAGG + Intergenic
1001619970 5:173075613-173075635 AAGAAAGACAACTTATCAGATGG - Intronic
1011964139 6:93132191-93132213 AAGAAAGGCAACTTAACAACAGG + Intergenic
1013064098 6:106666689-106666711 TAGGCAGGCAACTTATCATGTGG + Exonic
1014013378 6:116501767-116501789 CAGACAGGCACCTCAGCTGCAGG - Intronic
1014926172 6:127272972-127272994 CAGACAGACACCTTATAAACAGG - Intronic
1015853815 6:137602784-137602806 CAGAGAGGCAGCTTGTCAGCAGG - Intergenic
1020347240 7:7179117-7179139 CACTCAGGCAACTTATAAGGAGG - Intronic
1022316316 7:29248487-29248509 CAGGCAGGGAATTCATCAGCAGG - Intronic
1022370463 7:29766159-29766181 CAGTCCTGCCACTTATCAGCTGG - Intergenic
1022946388 7:35289431-35289453 GAGACAGTCATCTTATCAGACGG + Intergenic
1023403850 7:39811439-39811461 CAGTCATCCAACTTGTCAGCGGG - Intergenic
1023498946 7:40827897-40827919 CAGACGGGCAACTTCTGTGCTGG - Intronic
1042290160 8:67162469-67162491 CAGACAGGCTAATTAGCAGAAGG + Intronic
1044565375 8:93656773-93656795 CAAACAGTCAACTTACCAGCTGG + Intergenic
1047147771 8:122224116-122224138 CAGACTGACAATTTATCAGGAGG - Intergenic
1058618467 9:106860684-106860706 CAAAGAGGTAAATTATCAGCCGG + Intergenic
1060043518 9:120322335-120322357 CAGAAAGGAAACTTTTCAGAAGG - Intergenic
1060711471 9:125869547-125869569 CAGACAGCTAACTTCTCAGCAGG + Intronic
1186589883 X:10918789-10918811 TAGAAATGCAAATTATCAGCAGG + Intergenic
1187073150 X:15908646-15908668 CAGACTGGTAGCTTAGCAGCTGG + Intergenic
1189914392 X:45842530-45842552 CAAAGAGGCCACTTTTCAGCTGG + Intergenic
1189954463 X:46263335-46263357 CAGACAGACAGCTTGACAGCAGG - Intergenic
1191766597 X:64705193-64705215 GAGACAGACCACTTAGCAGCTGG + Intergenic
1202092286 Y:21205813-21205835 CAGGAAAGCAACCTATCAGCAGG + Intergenic