ID: 1125612597

View in Genome Browser
Species Human (GRCh38)
Location 15:40981972-40981994
Sequence GCAACTTATCAGCAGGACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 103}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125612589_1125612597 21 Left 1125612589 15:40981928-40981950 CCAAATCCTTCCTCATTCTTCTC 0: 1
1: 0
2: 10
3: 89
4: 749
Right 1125612597 15:40981972-40981994 GCAACTTATCAGCAGGACCATGG 0: 1
1: 0
2: 0
3: 3
4: 103
1125612590_1125612597 15 Left 1125612590 15:40981934-40981956 CCTTCCTCATTCTTCTCCTCCCT 0: 1
1: 2
2: 27
3: 320
4: 2754
Right 1125612597 15:40981972-40981994 GCAACTTATCAGCAGGACCATGG 0: 1
1: 0
2: 0
3: 3
4: 103
1125612595_1125612597 -5 Left 1125612595 15:40981954-40981976 CCTTTTGAATACAGACAGGCAAC 0: 1
1: 0
2: 0
3: 6
4: 163
Right 1125612597 15:40981972-40981994 GCAACTTATCAGCAGGACCATGG 0: 1
1: 0
2: 0
3: 3
4: 103
1125612591_1125612597 11 Left 1125612591 15:40981938-40981960 CCTCATTCTTCTCCTCCCTTTTG 0: 1
1: 0
2: 6
3: 104
4: 916
Right 1125612597 15:40981972-40981994 GCAACTTATCAGCAGGACCATGG 0: 1
1: 0
2: 0
3: 3
4: 103
1125612588_1125612597 26 Left 1125612588 15:40981923-40981945 CCAGTCCAAATCCTTCCTCATTC 0: 1
1: 0
2: 5
3: 32
4: 319
Right 1125612597 15:40981972-40981994 GCAACTTATCAGCAGGACCATGG 0: 1
1: 0
2: 0
3: 3
4: 103
1125612594_1125612597 -4 Left 1125612594 15:40981953-40981975 CCCTTTTGAATACAGACAGGCAA 0: 1
1: 0
2: 1
3: 21
4: 320
Right 1125612597 15:40981972-40981994 GCAACTTATCAGCAGGACCATGG 0: 1
1: 0
2: 0
3: 3
4: 103
1125612592_1125612597 -1 Left 1125612592 15:40981950-40981972 CCTCCCTTTTGAATACAGACAGG 0: 1
1: 0
2: 0
3: 13
4: 161
Right 1125612597 15:40981972-40981994 GCAACTTATCAGCAGGACCATGG 0: 1
1: 0
2: 0
3: 3
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125612597 Original CRISPR GCAACTTATCAGCAGGACCA TGG Intronic
900565408 1:3329510-3329532 GTAACTTAACAGGAGGACCGTGG + Intronic
901912299 1:12469569-12469591 GCTACTTATCAGCAAGATGATGG - Intronic
905125966 1:35716388-35716410 GCAACTTAGCTGCAGGGACAAGG + Intronic
909789388 1:79655170-79655192 GCAGTTTATAAACAGGACCATGG + Intergenic
910373530 1:86544145-86544167 GCAATTTATCAGCATTACAATGG - Intergenic
921468384 1:215519702-215519724 CCAAATTATAAACAGGACCAAGG + Intergenic
1067019982 10:42786866-42786888 GCAGCTGAACAGCAGGATCATGG + Intronic
1069658232 10:70106092-70106114 GCAGCCTCTCAGCAGGACAAGGG + Intronic
1070983165 10:80666412-80666434 GCAGCTTCTCTGAAGGACCATGG - Intergenic
1072105717 10:92271638-92271660 GCATCATATCAGAAGGAACATGG + Intronic
1074136319 10:110630053-110630075 GCAACTGATCAGCACCACGAAGG - Intergenic
1075233015 10:120700094-120700116 GCAACTTGTCTGCAGAAGCATGG - Intergenic
1075267040 10:121009794-121009816 GCAGCAAGTCAGCAGGACCAGGG - Intergenic
1076104992 10:127814707-127814729 GCAAGTTATCAGCTGGACTGGGG + Intergenic
1076273361 10:129175697-129175719 TTAAGGTATCAGCAGGACCAGGG + Intergenic
1079200794 11:18375872-18375894 GCACCCTCTCTGCAGGACCATGG - Intergenic
1079763846 11:24364856-24364878 GTAACTTACCAGCAAGCCCAGGG + Intergenic
1082051211 11:47771790-47771812 TCAACTTATCACCAGAACCTTGG + Intergenic
1084563882 11:69918922-69918944 GCAACTTTGCAGCAAGACCCCGG - Intergenic
1085054480 11:73395706-73395728 GCAACATGGCAGCAGGGCCAGGG - Exonic
1086744525 11:90408543-90408565 GCAACATATCAGGAGGCACACGG - Intergenic
1099137406 12:78924168-78924190 GCATCATATCAGAAGGCCCATGG + Intronic
1100157092 12:91812795-91812817 TCAAATTATCAGTAGTACCAAGG + Intergenic
1102595604 12:113990578-113990600 GCAAGGTCTCAGAAGGACCAGGG - Intergenic
1114778437 14:25512798-25512820 TCAACATGTCAGCAGGGCCAGGG - Intergenic
1117770058 14:59125025-59125047 GCTACACGTCAGCAGGACCAAGG + Intergenic
1119559575 14:75579229-75579251 GCAGCTAAACACCAGGACCACGG - Exonic
1119954588 14:78783180-78783202 GGAAATTATCACCAGGAACAAGG + Intronic
1125612597 15:40981972-40981994 GCAACTTATCAGCAGGACCATGG + Intronic
1130095321 15:80851216-80851238 GCAACTCCACAGCAGGGCCAGGG + Intronic
1131518151 15:93093141-93093163 GCAACTTATTAGCATGACTCTGG + Intergenic
1133079961 16:3310820-3310842 CCAACTTGTCAGCAGAGCCAAGG - Intronic
1134363793 16:13557602-13557624 GCCACTTCTCAGGAGGAACATGG + Intergenic
1136933200 16:34436747-34436769 GCATCTTCCCAGCAGGAGCAGGG + Intergenic
1136971372 16:34975067-34975089 GCATCTTCCCAGCAGGAGCAGGG - Intergenic
1139828345 16:69775742-69775764 GGAACTGATCAGCAGGAAGAAGG - Intronic
1140426616 16:74866581-74866603 CCAACTAATCAGCAGCACCTTGG - Intergenic
1142425494 16:90000257-90000279 GCACCGTGTCAGCAGGTCCAGGG - Intergenic
1143355560 17:6325538-6325560 GCACCTTAAGAGCAGGACCTTGG + Intergenic
1148735243 17:49861429-49861451 GCAAAATACCAGCAGGGCCAGGG + Intergenic
1160312678 18:77810523-77810545 GCCACTACTCAGCAAGACCAAGG - Intergenic
1160900866 19:1427697-1427719 GCAATGTGACAGCAGGACCAAGG - Intronic
1167479215 19:49719206-49719228 GTAACTTTTCAGCATGGCCATGG - Intergenic
1168097988 19:54126314-54126336 GCCACTTATCAGCTGGGACATGG + Intronic
926134827 2:10329251-10329273 GCAACATATCCGCAGGTCCCAGG - Intronic
926959483 2:18338623-18338645 GCCAGTTAACAGCAGAACCACGG + Intronic
933299695 2:80528045-80528067 GCAAATTAGCTGCATGACCAAGG + Intronic
935374531 2:102381101-102381123 TGAACTTAACAGCAGGGCCAGGG + Intronic
935925520 2:108064757-108064779 GCAACATATATGAAGGACCATGG - Intergenic
937276251 2:120685951-120685973 GCATCTTATCAGCCTCACCACGG + Intergenic
942377330 2:175351417-175351439 GAAACTTAACAGCTGGACCCTGG - Intergenic
942425465 2:175855870-175855892 GCAGCATTTCAGCAGGAGCACGG - Intergenic
948327190 2:237134306-237134328 GCAATTAGTCAGCAGGAGCAAGG + Intergenic
1172795937 20:37537620-37537642 GAAATGTATCAGCAGGACCTTGG + Intergenic
1176996539 21:15561460-15561482 GCCAGTTATCAGAAAGACCAAGG - Intergenic
1178668929 21:34573435-34573457 GGAACCTATGAGCAGGAGCAGGG - Intronic
1178899490 21:36587862-36587884 GCAACCTTTCACCAGGTCCAGGG + Intergenic
1180207883 21:46273480-46273502 GCCAGTGCTCAGCAGGACCATGG - Exonic
1185206910 22:49544918-49544940 GCATCTTATCAGCAGTAAAAAGG + Intronic
949108494 3:229360-229382 GCAACTTATCAACGGGGGCATGG - Intronic
950067694 3:10126303-10126325 GCAACTTCCCAGCAGCAGCACGG - Exonic
954400821 3:50318685-50318707 CCCACTTCTCAGCAGGAGCAGGG - Intronic
956685765 3:71825860-71825882 CCAACTTATCTGCATGGCCATGG + Intergenic
960989261 3:123300233-123300255 GCAGCTGATCTGCAGGAACACGG + Exonic
962866549 3:139452151-139452173 GTAACTCAGCAGAAGGACCAGGG + Intergenic
964361199 3:155898797-155898819 GCATCTTATCAGGAGGCACACGG + Intronic
965650989 3:170933181-170933203 GCAAACTATCACAAGGACCAAGG - Intergenic
969145803 4:5123223-5123245 GAAACTGACCAGCAAGACCACGG - Intronic
975390738 4:73814270-73814292 GCAACTTCTCACCAGTTCCATGG + Intergenic
983750198 4:171259000-171259022 AAAACTTATGAGTAGGACCAGGG + Intergenic
987714657 5:21551993-21552015 GCACAATCTCAGCAGGACCAGGG - Intergenic
996546589 5:124685641-124685663 GCAACTTATCAACAGACCCCAGG + Intronic
1006945514 6:37781965-37781987 GCTACTTATCAGCAGGAGAAGGG + Intergenic
1009002059 6:57730049-57730071 GCACAATCTCAGCAGGACCAGGG + Intergenic
1009344608 6:62597737-62597759 GCAAATTCTCACCAGGATCACGG + Intergenic
1010719678 6:79268851-79268873 GCATCATATCAGCAGGAGAATGG + Intergenic
1017801320 6:157898859-157898881 GCTGCCTGTCAGCAGGACCAGGG + Intronic
1021268807 7:18559293-18559315 CCACCTAATCAGCAGGACGAAGG - Intronic
1023019763 7:36000943-36000965 GCAGCATATCAGCAGGCACAAGG + Intergenic
1026061658 7:67031888-67031910 ACATCATATCAGCAGGAACATGG - Intronic
1026716692 7:72795546-72795568 ACATCTTATCAGCAGGAACATGG + Intronic
1032526735 7:132583494-132583516 GCAAGCTATCAGCAGGGCCAAGG + Intronic
1032803984 7:135338098-135338120 CCAAATTATCAACAGGACCTAGG + Intergenic
1033075637 7:138247693-138247715 GCGACTAAACAGCAGGACAAAGG + Intergenic
1033444453 7:141408155-141408177 GCTAGTTGTCAGCAGCACCAGGG + Intronic
1036650985 8:10643888-10643910 GAAACTGATCTGCAAGACCAGGG + Intronic
1037505190 8:19522639-19522661 GCAACTTACCAGAAGGACTCTGG + Intronic
1037770656 8:21797512-21797534 GGAGCTGATGAGCAGGACCAGGG - Intronic
1040022876 8:42756128-42756150 CCACCTCATCAGCAGGACCTGGG + Exonic
1041881092 8:62750711-62750733 GCAAATTGTCAGCAACACCAAGG + Intronic
1045330866 8:101154761-101154783 GCACCTTAGCAGCAGCAGCACGG - Intergenic
1046205466 8:110989579-110989601 GCATCATATCAGCAGGCACAAGG + Intergenic
1049282480 8:141757140-141757162 CCAGCTTCTCAGCAGCACCATGG + Intergenic
1051264694 9:15299285-15299307 GCATAATATCAGCAGTACCAAGG + Intronic
1052439270 9:28473184-28473206 ACAAGTTATCAGTAGAACCAAGG - Intronic
1056789658 9:89617348-89617370 GGAGCTTCTCAGCAGGGCCAGGG + Intergenic
1057008978 9:91584861-91584883 GCTAGTTAACAGCAGAACCAGGG + Intronic
1059955732 9:119514248-119514270 GTGACTTATCAGCTGGAACAAGG - Intronic
1060538319 9:124410810-124410832 GCAAATTATCAGGAAGGCCAGGG + Intronic
1060913022 9:127365784-127365806 GCTACTAAGCAGCAGGGCCAGGG + Intronic
1186392936 X:9179617-9179639 GCAACTTCCCAGCAGCAGCATGG - Intergenic
1187215277 X:17269748-17269770 CAAACTGATCAGCAAGACCAAGG + Intergenic
1188437238 X:30175065-30175087 GCAACCTCTCAGGATGACCATGG - Intergenic
1190429499 X:50365575-50365597 GCAAATAAGCAGCAGGGCCAGGG - Exonic
1191880307 X:65838693-65838715 GCAGCTGAGCAGCAGGCCCAGGG - Intergenic
1199241368 X:145551555-145551577 GCAAGGTGTCAGCAGGGCCATGG - Intergenic
1199920993 X:152404015-152404037 GCTACTCATCAGCAGTATCATGG + Intronic