ID: 1125612863

View in Genome Browser
Species Human (GRCh38)
Location 15:40983998-40984020
Sequence CTTCACAGTTGAGGCTGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 198}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125612853_1125612863 21 Left 1125612853 15:40983954-40983976 CCCTGTGCTCACCGCCCATGGCC 0: 1
1: 0
2: 0
3: 21
4: 215
Right 1125612863 15:40983998-40984020 CTTCACAGTTGAGGCTGCTTTGG 0: 1
1: 0
2: 0
3: 12
4: 198
1125612856_1125612863 7 Left 1125612856 15:40983968-40983990 CCCATGGCCTTGCACCCAGCTAG 0: 1
1: 0
2: 0
3: 4
4: 108
Right 1125612863 15:40983998-40984020 CTTCACAGTTGAGGCTGCTTTGG 0: 1
1: 0
2: 0
3: 12
4: 198
1125612861_1125612863 -8 Left 1125612861 15:40983983-40984005 CCAGCTAGGAACATGCTTCACAG 0: 1
1: 0
2: 1
3: 7
4: 132
Right 1125612863 15:40983998-40984020 CTTCACAGTTGAGGCTGCTTTGG 0: 1
1: 0
2: 0
3: 12
4: 198
1125612854_1125612863 20 Left 1125612854 15:40983955-40983977 CCTGTGCTCACCGCCCATGGCCT 0: 1
1: 0
2: 0
3: 19
4: 186
Right 1125612863 15:40983998-40984020 CTTCACAGTTGAGGCTGCTTTGG 0: 1
1: 0
2: 0
3: 12
4: 198
1125612855_1125612863 10 Left 1125612855 15:40983965-40983987 CCGCCCATGGCCTTGCACCCAGC 0: 1
1: 0
2: 2
3: 16
4: 278
Right 1125612863 15:40983998-40984020 CTTCACAGTTGAGGCTGCTTTGG 0: 1
1: 0
2: 0
3: 12
4: 198
1125612860_1125612863 -7 Left 1125612860 15:40983982-40984004 CCCAGCTAGGAACATGCTTCACA 0: 1
1: 1
2: 1
3: 11
4: 110
Right 1125612863 15:40983998-40984020 CTTCACAGTTGAGGCTGCTTTGG 0: 1
1: 0
2: 0
3: 12
4: 198
1125612859_1125612863 0 Left 1125612859 15:40983975-40983997 CCTTGCACCCAGCTAGGAACATG 0: 1
1: 0
2: 0
3: 13
4: 168
Right 1125612863 15:40983998-40984020 CTTCACAGTTGAGGCTGCTTTGG 0: 1
1: 0
2: 0
3: 12
4: 198
1125612852_1125612863 22 Left 1125612852 15:40983953-40983975 CCCCTGTGCTCACCGCCCATGGC 0: 1
1: 0
2: 0
3: 16
4: 203
Right 1125612863 15:40983998-40984020 CTTCACAGTTGAGGCTGCTTTGG 0: 1
1: 0
2: 0
3: 12
4: 198
1125612857_1125612863 6 Left 1125612857 15:40983969-40983991 CCATGGCCTTGCACCCAGCTAGG 0: 1
1: 0
2: 1
3: 26
4: 248
Right 1125612863 15:40983998-40984020 CTTCACAGTTGAGGCTGCTTTGG 0: 1
1: 0
2: 0
3: 12
4: 198
1125612850_1125612863 23 Left 1125612850 15:40983952-40983974 CCCCCTGTGCTCACCGCCCATGG 0: 1
1: 0
2: 0
3: 17
4: 187
Right 1125612863 15:40983998-40984020 CTTCACAGTTGAGGCTGCTTTGG 0: 1
1: 0
2: 0
3: 12
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125612863 Original CRISPR CTTCACAGTTGAGGCTGCTT TGG Intronic