ID: 1125619248

View in Genome Browser
Species Human (GRCh38)
Location 15:41045001-41045023
Sequence CGCTCCTGGGGAGCGCCAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125619248_1125619256 14 Left 1125619248 15:41045001-41045023 CCTTCTGGCGCTCCCCAGGAGCG 0: 1
1: 0
2: 2
3: 8
4: 104
Right 1125619256 15:41045038-41045060 TGTAGGAGGCTTTCAGAGACAGG 0: 1
1: 0
2: 2
3: 16
4: 188
1125619248_1125619253 -3 Left 1125619248 15:41045001-41045023 CCTTCTGGCGCTCCCCAGGAGCG 0: 1
1: 0
2: 2
3: 8
4: 104
Right 1125619253 15:41045021-41045043 GCGTAGCTGATGGAGCCTGTAGG 0: 1
1: 0
2: 0
3: 4
4: 96
1125619248_1125619254 0 Left 1125619248 15:41045001-41045023 CCTTCTGGCGCTCCCCAGGAGCG 0: 1
1: 0
2: 2
3: 8
4: 104
Right 1125619254 15:41045024-41045046 TAGCTGATGGAGCCTGTAGGAGG 0: 1
1: 0
2: 0
3: 7
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125619248 Original CRISPR CGCTCCTGGGGAGCGCCAGA AGG (reversed) Exonic
901768409 1:11518276-11518298 CGCCCATGGTGAGCCCCAGAGGG + Intronic
902403824 1:16172453-16172475 CGTTCCTGGGAAGACCCAGAAGG + Intergenic
903696460 1:25210906-25210928 GGCTCCTGGAGAGCCTCAGATGG - Intergenic
905297458 1:36963160-36963182 AGCTCCTGTGGAGAGGCAGATGG - Intronic
906950883 1:50333664-50333686 AGCGCCGGAGGAGCGCCAGAAGG - Intergenic
907239616 1:53074268-53074290 CCCTCCAGGAGAGCCCCAGAAGG - Intronic
912623412 1:111188461-111188483 AGCTCCTGGGGAAAGCCATAGGG + Intronic
919645545 1:200091025-200091047 AGCTGCTGGGGAGACCCAGAGGG - Intronic
919768849 1:201144399-201144421 TGCTCCTGTGGAGAGCAAGACGG + Intronic
1062982507 10:1737121-1737143 CGGTCCTGGGGAGCGGCAGAGGG - Exonic
1063338985 10:5245079-5245101 TGCTTCTGGGGAGGGCCACAGGG - Intergenic
1063344113 10:5295288-5295310 TGCTTCTGGGGAGGGCCACAGGG + Intergenic
1065687728 10:28302829-28302851 CGCCTCTGGGGAGCGCCTGTCGG - Intronic
1074687327 10:115972697-115972719 GGTGGCTGGGGAGCGCCAGAGGG - Intergenic
1075105547 10:119537940-119537962 CGCTCCTGGGGAGAGACACTGGG - Intronic
1078106460 11:8361189-8361211 TGCACCTGGGCAGGGCCAGAGGG + Intergenic
1078146789 11:8727143-8727165 GGCTCCTGGGGAGGGAAAGAAGG + Intronic
1084473417 11:69375968-69375990 TTCGCCTGGGGAGGGCCAGATGG - Intergenic
1091601051 12:1918011-1918033 GGCTCCTGGGGAGAGGCAGGTGG + Intronic
1092385449 12:8032978-8033000 CGCTCCCGGGGTGCCCCAGAGGG - Exonic
1096699209 12:53371332-53371354 TGCGGCTGGGGAGAGCCAGAGGG + Intergenic
1098104511 12:67055288-67055310 CGCTCCTGGAGTGGGCCAGAGGG + Intergenic
1104949176 12:132431295-132431317 CGCATCTGGGGAGCGCCTGCCGG - Intergenic
1118137500 14:63045587-63045609 CCCTGCTGGGGAGCGCAAGCGGG + Intronic
1119562498 14:75602314-75602336 CGCTCCTAGGTAGCCTCAGAAGG - Intronic
1119747232 14:77053005-77053027 AGCTTCTGGAGAGGGCCAGATGG - Intergenic
1122644896 14:103187867-103187889 GCCTCCTGGGGAGCTTCAGAAGG - Intergenic
1122906267 14:104802975-104802997 CACTCCTGGGGAGCGGCAGCAGG + Exonic
1125619248 15:41045001-41045023 CGCTCCTGGGGAGCGCCAGAAGG - Exonic
1129251014 15:74308987-74309009 GGCTCCTGTGGAGGGCCAGTGGG + Intronic
1132768745 16:1549007-1549029 CGCTGCTGGAGAGCGCCAGGTGG - Intronic
1132906540 16:2285427-2285449 TGCTGCTGGTGAGCGCCGGAGGG - Exonic
1133051291 16:3118850-3118872 TGCAGCTGGGCAGCGCCAGAAGG + Intronic
1136092295 16:27929173-27929195 GGCTCCTGGGAAGGGACAGACGG + Intronic
1136111133 16:28064026-28064048 CCCTCTTGGGGAGCCCCAGCAGG - Intergenic
1137618071 16:49858401-49858423 CGCGGCTGGGGAGCGCGAGCTGG + Intergenic
1138521950 16:57576094-57576116 TCCTCCAGGGGAGGGCCAGATGG + Exonic
1139421349 16:66851298-66851320 GGGTCCAGGGGAGCCCCAGAGGG - Intronic
1139572832 16:67824094-67824116 CCCTGCTGTGGAGCACCAGAAGG - Intronic
1140457149 16:75112148-75112170 GGCTCCTGGGGCCAGCCAGAGGG + Exonic
1142167308 16:88599134-88599156 TGCTCCTGGGCAGTGCCAGCTGG - Intronic
1142206500 16:88785389-88785411 CGCTCCGGGCCAGCGCCAGTCGG - Intergenic
1143829520 17:9639861-9639883 CTCTCCTGGGCAGCCCCAGTAGG - Intronic
1144348754 17:14373855-14373877 CGATCCTGGGAAACACCAGAAGG + Intergenic
1144802900 17:17943391-17943413 TGCTGCTGGGGTGCGACAGAGGG + Intronic
1146169528 17:30621850-30621872 CGGGCCTGGGTGGCGCCAGAAGG + Intergenic
1146170034 17:30625599-30625621 CGGGCCTGGGTGGCGCCAGAAGG - Intergenic
1147448721 17:40490577-40490599 CGCTCCTGGGTAGGGCCATCTGG + Intronic
1148975100 17:51520541-51520563 GGCTCCTGGGTAGCCCAAGATGG - Intergenic
1151963397 17:77419194-77419216 CCCGCCTGGGGAGGGGCAGAGGG - Intronic
1152205489 17:78972400-78972422 CGCTCCTGGGCAGCAGCAGTTGG + Exonic
1152689775 17:81712629-81712651 CCCTCCTGGAGAGCGCGAGGAGG + Intronic
1158393582 18:57062885-57062907 GGCTCCTGGGCAGCGGCACATGG - Intergenic
1160691739 19:463547-463569 AGCTACTGGGGAGGGCCGGAAGG + Exonic
1160952109 19:1672509-1672531 CGCACGTGGGGAGCGCCCGCGGG - Intergenic
1160965911 19:1746826-1746848 CGCTCCCTGGGATCGCCCGAAGG + Intergenic
1161959505 19:7516109-7516131 CGCTCCCCGGGAGCGCCTGGCGG + Exonic
1162566855 19:11449248-11449270 CGCACCTGGGGATGGGCAGACGG - Exonic
1163505028 19:17700548-17700570 CTCCCCTAGGGAGCCCCAGATGG - Intergenic
1163830993 19:19547105-19547127 CGGCCCTGTGGAGCGCCAGGAGG - Intergenic
1164723675 19:30451146-30451168 GGCTCCTGGGGAATGTCAGATGG + Intronic
1166202684 19:41248725-41248747 CTCTCCTGTGGGGGGCCAGAGGG - Exonic
1166455598 19:42937571-42937593 CACTGCAGGGGAGAGCCAGATGG - Intronic
1168474311 19:56664925-56664947 CGCGCCTGGGGAGAGCCCGAAGG - Exonic
1168677820 19:58291717-58291739 TGCACCTGGGGAGGGCAAGATGG + Intronic
926113104 2:10195143-10195165 AGCTCCTGGGGAGCTACCGAGGG + Intronic
926299925 2:11595288-11595310 CACTCCTGCGGAGTACCAGAAGG + Exonic
927148636 2:20183208-20183230 AGCTACTGGGGACCCCCAGAAGG + Intergenic
927878168 2:26672648-26672670 AACTCCTGGGGAGAGGCAGAAGG - Intergenic
927883730 2:26706220-26706242 AGCTCCTGGGGTGAGCCAGGTGG + Intronic
932209562 2:69915529-69915551 CGCGCGTGGGGAGAGCCAGAGGG - Intronic
935249924 2:101252578-101252600 CCGTCCTGGGGACCGCCAAAGGG + Intronic
946862750 2:224015355-224015377 TGCTCCTGGGAAGGGCCACATGG + Intronic
948109615 2:235444204-235444226 CACACCTGGGGAGGGGCAGAAGG + Intergenic
948887027 2:240889610-240889632 CTCTCCTGGGAACCCCCAGAGGG + Intronic
1171115794 20:22523900-22523922 TGCTCCAGGGAAGGGCCAGATGG - Intergenic
1172113049 20:32558769-32558791 AGCCCCTGGGGAGCCCCTGAAGG + Intronic
1175374826 20:58516805-58516827 AGCTCTTTGGGAGAGCCAGACGG + Intergenic
1177869541 21:26554604-26554626 CTCTCCTGGGGAGAGGCAGGTGG + Intronic
1178615636 21:34130415-34130437 CTCTCCAGGGGAGGGGCAGAAGG + Intronic
1178925942 21:36775090-36775112 TGCTTCTGGGGAGCTCCAGTGGG - Intronic
1179885373 21:44312034-44312056 AGCCCCTGGGGATCACCAGAGGG - Intronic
1179980505 21:44893289-44893311 GGGTCCTGGGGACAGCCAGAAGG - Intronic
1180835394 22:18927069-18927091 CACTCCTGGGCAGCCCCACATGG + Intronic
1181684609 22:24519889-24519911 CTCTCCTGGTGAATGCCAGAAGG - Intronic
1181711982 22:24696682-24696704 CACTCCTGGGCAGCCCCACATGG + Intergenic
1182065749 22:27430467-27430489 GGCTCCTGGGGGACGCCAAAGGG - Intergenic
1183249730 22:36721713-36721735 CGCCCCTAGGGAGAGACAGAGGG + Intergenic
1184102422 22:42347780-42347802 CGCTCCTGCGGCGCCCCAGCTGG - Intergenic
1185219619 22:49622840-49622862 CGCCCCTTGGGAGGGCCAGGGGG - Intronic
1203285482 22_KI270734v1_random:152368-152390 CACTCCTGGGCAGCCCCACATGG + Intergenic
953606681 3:44417164-44417186 CCGTCCTGGGGAGCCACAGAAGG - Intergenic
953757622 3:45660745-45660767 TGTTCCTGGGGAGGGACAGAGGG + Intronic
961633084 3:128315565-128315587 AGCTCCTGGGGAGGCCCAGGAGG + Intronic
978529953 4:109703109-109703131 CGCTACTCGGGACCGCCAGGAGG + Intronic
979670352 4:123354712-123354734 TGCTCTTGGGGTGGGCCAGATGG - Intergenic
982399840 4:154954318-154954340 CTCTCCTGGGGATCCCCAAAGGG - Intergenic
1001205593 5:169759842-169759864 CTCTTATGGGGAGCTCCAGATGG + Intronic
1016004527 6:139075748-139075770 AGCTCTTGGGGAGCCCCAAAAGG - Intergenic
1018103599 6:160463239-160463261 CACTCCTGGGGAGAGCAAGAGGG - Intergenic
1018111892 6:160544485-160544507 CACTCCTGGGGAGAGCAAGAGGG - Intronic
1018752655 6:166821279-166821301 CACTCCTGGGGTGCGCCTGCTGG - Intronic
1027236697 7:76302738-76302760 CGCTCCTGCGGGGCCCCAGCTGG + Exonic
1042915132 8:73868104-73868126 GGCTCCTGGAGAGCCTCAGAAGG + Intronic
1043486881 8:80706543-80706565 TGCTCCTGGGGAGCCCAATATGG - Intronic
1049807788 8:144548666-144548688 AGCTCCAGGAGAGCCCCAGAGGG - Intronic
1059225660 9:112670793-112670815 CGCTCCTGGGGAGCGCTAGTGGG + Intergenic
1060052015 9:120384408-120384430 TGCTCCTGGTGAGGCCCAGAGGG - Intergenic
1060190294 9:121588430-121588452 TGCTCCTGGGGAACCCCAGTTGG - Intronic
1062337773 9:136079958-136079980 CCCTCCTGGAGAGCTACAGATGG + Intronic
1187226123 X:17376372-17376394 CGCTGCTGGGGAGGGCGCGAGGG - Intronic
1187735979 X:22303957-22303979 CGCTCAGGGGGATCTCCAGAAGG + Intergenic
1191700550 X:64037687-64037709 TGCTCCTGGGGGGTGGCAGATGG - Intergenic
1197215218 X:123860391-123860413 CGCTGCTGGGGAGGGCGGGAAGG + Intronic
1201017906 Y:9624119-9624141 GGCTCCTGGGGAGCTCCTCAGGG - Intergenic