ID: 1125619367

View in Genome Browser
Species Human (GRCh38)
Location 15:41046070-41046092
Sequence ACTTGTTTCTACAGGGCAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125619367_1125619371 3 Left 1125619367 15:41046070-41046092 CCGTTTGCCCTGTAGAAACAAGT 0: 1
1: 0
2: 1
3: 16
4: 142
Right 1125619371 15:41046096-41046118 CAAGACTTACTAGAAATTATGGG 0: 1
1: 0
2: 1
3: 13
4: 231
1125619367_1125619370 2 Left 1125619367 15:41046070-41046092 CCGTTTGCCCTGTAGAAACAAGT 0: 1
1: 0
2: 1
3: 16
4: 142
Right 1125619370 15:41046095-41046117 ACAAGACTTACTAGAAATTATGG 0: 1
1: 0
2: 1
3: 19
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125619367 Original CRISPR ACTTGTTTCTACAGGGCAAA CGG (reversed) Intronic
900768599 1:4522143-4522165 ACTTCTTCCTACAGGCCATAGGG - Intergenic
906416207 1:45622782-45622804 ACTTTATTCTCCAGTGCAAAAGG - Exonic
907837289 1:58122280-58122302 AATTGTTGCAACATGGCAAAGGG + Intronic
909658070 1:78053028-78053050 ACTTGTTTTTCCAGGGCAGGGGG - Intronic
912361839 1:109101660-109101682 ACTTGTATCCCCAGGGCTAACGG + Intergenic
913537395 1:119786194-119786216 ACATATTTCTACAGAGCACAAGG - Intergenic
915734879 1:158078401-158078423 CCTTGTTTCTAAAAGGCAGAAGG - Intronic
918979072 1:191531509-191531531 AGTTATTTTTACAAGGCAAAGGG + Intergenic
919185838 1:194148115-194148137 ACTTGATTCTAGAGGTAAAATGG + Intergenic
919512240 1:198479747-198479769 GCTTGTTTCTATAGGGCCTATGG + Intergenic
921616318 1:217271962-217271984 ATTTGATTCTAGAGGGCAAGAGG - Intergenic
1064448052 10:15414108-15414130 ACTTTTTTCTAAATGGGAAAAGG - Intergenic
1065849676 10:29777325-29777347 TCTTATTTCTAGAGGTCAAAGGG - Intergenic
1066266539 10:33781352-33781374 GTTTCTTTCTACAGGGAAAATGG - Intergenic
1067321505 10:45225023-45225045 TCTTGTTGCTTAAGGGCAAAAGG - Intergenic
1067898850 10:50216549-50216571 ATTTATTTTTAAAGGGCAAAGGG - Intronic
1069278325 10:66621017-66621039 AATTATTTCTACATGACAAATGG - Intronic
1069638381 10:69939610-69939632 AATTGCTTCTGCAGGGCAAATGG - Intronic
1072006423 10:91254020-91254042 ACTTAATTGTACAGGCCAAAAGG - Intronic
1073120672 10:101121026-101121048 AGTTGGTACAACAGGGCAAAGGG + Intronic
1073724777 10:106217627-106217649 AATTGTTTCTTAAGGGGAAAAGG + Intergenic
1074123633 10:110511410-110511432 AGTTATTTCTCCAGGGGAAAAGG + Exonic
1076359987 10:129881426-129881448 ACTTGTTTCTCCCAGGCAGAGGG + Intronic
1083430192 11:62610380-62610402 ACTTACTTCTAGAGGGCAAGAGG - Intronic
1086877984 11:92120768-92120790 ATTTGCTTCTACATGGCAAGGGG + Intergenic
1088448463 11:109956879-109956901 AATTATATCTACAAGGCAAAAGG + Intergenic
1090286548 11:125504642-125504664 ATTTGTTTCCACAAGGGAAATGG + Intergenic
1090786332 11:130051166-130051188 TCTTGTTTCTTCATAGCAAAAGG - Intergenic
1091210031 11:133849349-133849371 ACGTGCTTTTGCAGGGCAAAAGG - Intergenic
1098017011 12:66115574-66115596 AGTTGTCTCTAGAGGACAAATGG - Intergenic
1098626512 12:72677759-72677781 ACTTTTTTCAACAGACCAAAGGG - Intergenic
1099094636 12:78358492-78358514 ATGTGTTTCTCCAGGGCAAACGG + Intergenic
1099539613 12:83890482-83890504 ATTTGATTCTAGAGGTCAAAAGG - Intergenic
1100813094 12:98359888-98359910 AGGAGTTTCTACAGGACAAACGG + Intergenic
1102612070 12:114121071-114121093 ACCTGATGCCACAGGGCAAAGGG + Intergenic
1105252996 13:18717485-18717507 AGTGGTCTCTACTGGGCAAAAGG - Intergenic
1107029273 13:35834311-35834333 TCTTATTTGTACAGGGCCAAAGG + Intronic
1108543077 13:51462469-51462491 ACTCATTTCTAAAGGACAAATGG + Intergenic
1108764345 13:53608419-53608441 TCTGGCTTCTACAGGGAAAAAGG - Intergenic
1111175402 13:84588979-84589001 ACCTGTTTCTATAGGATAAAAGG + Intergenic
1113005414 13:105696360-105696382 AGTTGCTCCTAGAGGGCAAATGG + Intergenic
1117140122 14:52781458-52781480 ATTTGTTTCCACATGGTAAAGGG - Intronic
1118865785 14:69702516-69702538 ACCAGTTTCAAGAGGGCAAAGGG + Intronic
1119562939 14:75605372-75605394 CCTTGATTCTACAGAGCTAAGGG + Intronic
1119846555 14:77834783-77834805 ACCTGGTTCTACAGGGTAAGTGG + Intronic
1121945582 14:98118499-98118521 ACTTGTCTCTATCGGGCCAATGG - Intergenic
1125619367 15:41046070-41046092 ACTTGTTTCTACAGGGCAAACGG - Intronic
1127215175 15:56816329-56816351 ACGTGGATCTAAAGGGCAAATGG + Intronic
1127729843 15:61789681-61789703 GATGGATTCTACAGGGCAAAGGG + Intergenic
1130616728 15:85416580-85416602 ACTAGTTTTTAGTGGGCAAAAGG + Intronic
1130852449 15:87808161-87808183 ACTTGTTTGAACAGTGCAAAAGG - Intergenic
1131118897 15:89810957-89810979 ACTTGTGTCTCCAGGGCAAGTGG - Intronic
1131929754 15:97428261-97428283 ATTTTATTCCACAGGGCAAAAGG + Intergenic
1135050941 16:19192548-19192570 TCCTGTTTCTACAGGAAAAAGGG + Intronic
1137751983 16:50870342-50870364 ACTGGTTGCTACAGGACAAAAGG - Intergenic
1138839997 16:60489000-60489022 ACTTGGTTCTATAGGAAAAAAGG + Intergenic
1144027279 17:11288907-11288929 ACTTCTTTCTAGAGTGGAAATGG + Intronic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1145736482 17:27235850-27235872 ACCTGGTGCTACAGGCCAAAGGG - Intergenic
1149042196 17:52203314-52203336 ACTTGTTTCTATAGGCAATATGG - Intergenic
1149249441 17:54750969-54750991 TTTTGTTTTTACAGTGCAAATGG + Intergenic
1149673834 17:58440449-58440471 ATTTGTTTCTACCAGGCAATTGG - Intronic
1156347767 18:36273398-36273420 ACATGTTTGTTCAGGGCAAATGG + Intergenic
1157431068 18:47627137-47627159 ACTTGTGCCAACAGGGCAGAAGG - Intergenic
1159121617 18:64177776-64177798 ACATTTTGCTCCAGGGCAAAGGG + Intergenic
1165960426 19:39529567-39529589 ACATTTTTCTGCATGGCAAAAGG + Intergenic
1168360782 19:55738132-55738154 ACCTGTTTCTACAGATCAATAGG - Exonic
926939225 2:18117499-18117521 ACTTTCTTCCACAGGTCAAATGG + Intronic
927694411 2:25230460-25230482 CCTTGTTTCTAAGGGGGAAATGG + Exonic
927839467 2:26430182-26430204 ACTTGTTTCTTTAAGGCAATTGG + Intronic
932008506 2:67952165-67952187 ACTTGTTCCTACAGCTTAAAAGG - Intergenic
933184555 2:79264228-79264250 AGTTGTATCTAAAGGGCTAAGGG + Intronic
933294738 2:80476369-80476391 ACTTACTTCTCCAGGGGAAAAGG + Intronic
933571986 2:84024893-84024915 ATATGTTCTTACAGGGCAAAAGG + Intergenic
935725977 2:106024426-106024448 ACATTTTTCTACAAGGTAAAAGG + Intergenic
935837316 2:107069111-107069133 ACTGACTTCTTCAGGGCAAAGGG - Intergenic
940604622 2:155904833-155904855 ACCTGTTCCTTCAGTGCAAAGGG + Intergenic
1174184005 20:48692842-48692864 ACTGTTTTCAACAGCGCAAAGGG + Intronic
1175670522 20:60899109-60899131 ACTTATTTATACATGGGAAACGG - Intergenic
1176838506 21:13817367-13817389 AGTGGTCTCTACTGGGCAAAAGG - Intergenic
1177904778 21:26962186-26962208 TTTTGTTTCTAAAGAGCAAATGG + Intronic
1178139811 21:29669897-29669919 AGTTTTTTCTCCAGGGCAAATGG + Intronic
1182089231 22:27582916-27582938 ACATGTTTTGACAGGGCAAGGGG + Intergenic
1182757924 22:32695768-32695790 ACTCATTTCTATAAGGCAAAGGG - Intronic
1183840086 22:40492249-40492271 ACTTCATTCTACAGTGCAAAGGG + Intronic
1184755874 22:46515403-46515425 ACATGTTTCATCAGGGTAAAGGG + Intronic
950505534 3:13392151-13392173 GCTGTTTTCTACAGTGCAAAGGG + Intronic
950952961 3:17020629-17020651 ACTATTTTCTACTGGGGAAATGG - Intronic
953006293 3:38982334-38982356 ATTTGTTTCCACAGAGCAAGAGG + Intergenic
959365197 3:105449084-105449106 ACATGTTTCTACATGGTAAAAGG + Intronic
967752655 3:193132063-193132085 ACTTCTTTCTTGAGGGCAAAAGG - Intergenic
968375443 4:36525-36547 TCTTGTTATTACAAGGCAAATGG - Intergenic
971712329 4:30130357-30130379 ACATTTCCCTACAGGGCAAAGGG + Intergenic
971891443 4:32528957-32528979 CCTTTTTTCTACCGTGCAAATGG - Intergenic
973695481 4:53486391-53486413 TCTTTTTTCTACAGGCCAAGAGG + Intronic
975845398 4:78519822-78519844 TCTTGTTTTTACAGAGCAAAAGG + Intronic
982431715 4:155330096-155330118 TCTTGTTTCTAAAAGGCCAAAGG + Intergenic
986604195 5:9505251-9505273 ACTTATTTCTAGAAGGCAAAAGG + Intronic
986904643 5:12480657-12480679 ATTTTTTTCCACTGGGCAAATGG - Intergenic
987819464 5:22943635-22943657 TCTTGTTTCCACAGGACAAAAGG + Intergenic
987918885 5:24252142-24252164 CCTTGTCTCCACAGGGCAGAAGG + Intergenic
988290860 5:29284143-29284165 ACTTGTTTGGCCAGTGCAAAAGG + Intergenic
989724056 5:44566263-44566285 TCTTTTTTCTAAATGGCAAAAGG - Intergenic
995917493 5:117266200-117266222 ACTTGTTTCTACCAGTCAACTGG + Intergenic
996561337 5:124832842-124832864 CCTTCTTTCTACAAGGAAAAAGG - Intergenic
996871124 5:128194346-128194368 ACTTTTTTCTTCATGACAAACGG + Intergenic
997652128 5:135530204-135530226 ACTCCTTTCTACAGGACTAATGG + Intergenic
1000572328 5:162930151-162930173 TCTTGTTTCTACAGGGGGACTGG + Intergenic
1004421837 6:15477442-15477464 ACTTGTCTCAACAGGAAAAATGG - Intronic
1005312026 6:24567902-24567924 ACTTGTTTCTAAGGGGAAATTGG - Intronic
1008393131 6:50976145-50976167 AAGTGATCCTACAGGGCAAATGG - Intergenic
1008401284 6:51066289-51066311 ACTTGCTTCTACAGGTACAAAGG + Intergenic
1008765321 6:54905869-54905891 ACATGTTTATAGGGGGCAAATGG - Intronic
1009656569 6:66553945-66553967 ACAAGTTTCTACACAGCAAAAGG - Intergenic
1010114086 6:72280794-72280816 ATTTGTTTCTTGAAGGCAAAGGG - Intronic
1010841849 6:80655680-80655702 AGTTGTGTATACAGGACAAAGGG + Intergenic
1011743373 6:90386014-90386036 AATTGTTTCAACAGTGCTAAAGG + Intergenic
1011774549 6:90714881-90714903 ACCTGTTTCTTTAGGGCAACAGG - Intergenic
1013055036 6:106575093-106575115 ACTTGTTTGTTAAGGACAAAGGG + Intronic
1013650405 6:112188916-112188938 ACTTGATTCCCTAGGGCAAATGG - Intronic
1014003836 6:116395061-116395083 ACTTATTTCTCCAGGACAGAAGG + Intronic
1014116393 6:117672982-117673004 AGTTTTTACTACAGGGCAATGGG + Intergenic
1014334623 6:120117380-120117402 TTTTGTTTCTCCAGGGTAAATGG + Intergenic
1015531368 6:134224617-134224639 ATTTATTTTTACAGGGCAATGGG + Intronic
1019289254 7:242353-242375 CCTTGTGTGTACAGGGCAAGGGG + Intronic
1019883378 7:3883087-3883109 ACTGGTTTCTACAGAGCCCACGG + Intronic
1021140014 7:17012731-17012753 AACTGTTTCTTCAGGGCCAAGGG - Intergenic
1023248773 7:38235293-38235315 ACTTTTTTCTAAATGGGAAATGG + Intergenic
1030380595 7:108806867-108806889 TCTAGTTTCTACAGGGGAAATGG - Intergenic
1031888938 7:127271884-127271906 ACTTTTTTTAAAAGGGCAAAAGG + Intergenic
1032504791 7:132426865-132426887 ACTTGTCTCTAAGGGGGAAAAGG + Intronic
1033948496 7:146752981-146753003 ACTTGTTTCTTTAGAGCCAAGGG + Intronic
1037433826 8:18842309-18842331 AGTAGTCTCTACAGCGCAAAAGG - Intronic
1038676059 8:29624052-29624074 ACTTCCTGGTACAGGGCAAAGGG - Intergenic
1038869230 8:31475956-31475978 ACTTGTGTGTCCAGGGCAAAAGG + Intergenic
1042210875 8:66379093-66379115 ACGTGTTTCAACAAGGAAAAAGG + Intergenic
1044243205 8:89911295-89911317 AAATGTTACTACAGAGCAAAAGG - Intronic
1044563678 8:93639566-93639588 ACTTATTTCCACAGACCAAAGGG - Intergenic
1046301759 8:112303149-112303171 ATTTGTTTTTAAAGGGCACATGG - Intronic
1047581005 8:126215329-126215351 ACTTTTTTCTAAAGTGCATATGG + Intergenic
1048102661 8:131371222-131371244 ACTTCTTCCCACAGGGGAAAGGG + Intergenic
1050797657 9:9564353-9564375 ACTTGTTTCTAAAGGGTAACAGG - Intronic
1051859771 9:21611274-21611296 ACTTGTGTAGACAGGGCAGATGG - Intergenic
1056897095 9:90561144-90561166 ACTTCTTTCGACAGATCAAAAGG - Intergenic
1059298197 9:113291346-113291368 ACTTGTTTCTACAGACTTAAGGG - Intronic
1203573783 Un_KI270744v1:157619-157641 TCTTGTTATTACAAGGCAAATGG + Intergenic
1186695995 X:12032637-12032659 AATGGTTTCTACAGCACAAATGG + Intergenic
1187273360 X:17798417-17798439 ACTTGCTTCTAAAGGGCAAATGG + Intergenic
1188967279 X:36569978-36570000 GCTTGTTTCTGCTGGACAAAGGG + Intergenic
1190271106 X:48864464-48864486 ATTTATATCTACAAGGCAAAAGG - Intergenic
1190630613 X:52381674-52381696 ACTTGATTTTAGAGGGAAAATGG + Intergenic
1190633310 X:52410791-52410813 ACTTGATTGTACAGAGGAAATGG - Intergenic
1190953904 X:55172334-55172356 ACTTGATTTTAGGGGGCAAATGG + Intronic
1193996417 X:88370437-88370459 ACTTGTTTCCCCATGGAAAAAGG - Intergenic
1197159733 X:123309757-123309779 ACTTGTTTCTACACAGCCACTGG - Intronic
1197250644 X:124212994-124213016 ATTTTATTCTTCAGGGCAAAGGG - Intronic
1197652790 X:129084170-129084192 ACTTGATTCTCCAGGACAACAGG + Intergenic
1197959313 X:131986633-131986655 AAATGTTTCTACAGGGCTGAAGG - Intergenic
1198412996 X:136390663-136390685 ACTTGAGCCTACAGTGCAAAGGG + Intronic
1200049854 X:153422983-153423005 CCCTGTTTCTGCAGGGCTAAGGG - Intergenic