ID: 1125622997

View in Genome Browser
Species Human (GRCh38)
Location 15:41081447-41081469
Sequence CTCCTAATGATTCCTGTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125622997_1125622999 28 Left 1125622997 15:41081447-41081469 CCAGATACAGGAATCATTAGGAG 0: 1
1: 0
2: 0
3: 2
4: 89
Right 1125622999 15:41081498-41081520 TCTAGCCCCACCTCCAGCCTAGG 0: 1
1: 0
2: 5
3: 76
4: 754

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125622997 Original CRISPR CTCCTAATGATTCCTGTATC TGG (reversed) Intronic
900562417 1:3313863-3313885 CTATTAATGCTTCCTGTCTCTGG - Intronic
904198650 1:28804772-28804794 CTCATGATGATTCCTCTAACAGG + Intergenic
905698470 1:39993647-39993669 CTACCAATAATTCCTGTATAAGG - Intergenic
911645035 1:100328745-100328767 CACCTGATGTTTCCTGTACCTGG + Intergenic
912589524 1:110802256-110802278 CTCCTGATGCTTCCTGTAGGTGG - Intergenic
914849989 1:151307223-151307245 ATCCTTATGGTTGCTGTATCTGG + Intronic
919138982 1:193546284-193546306 CACTTACTGCTTCCTGTATCAGG + Intergenic
921144436 1:212339569-212339591 CACCTAATGTTTACTGTGTCAGG + Intronic
923042284 1:230327782-230327804 CTCCTGAGGATTCCTGTCCCCGG + Intronic
1063188368 10:3670358-3670380 CTCCTCATGACTTCTGTATTTGG + Intergenic
1075793613 10:125103466-125103488 AGCCTTCTGATTCCTGTATCAGG - Intronic
1082058757 11:47842686-47842708 TTCTTAATGATTTCAGTATCAGG + Intronic
1082950366 11:58808622-58808644 CTCCCAAATATTCCTGTCTCAGG + Intergenic
1082994069 11:59234687-59234709 CTCCAAATGATTCCTGAATTTGG + Intergenic
1084477716 11:69398451-69398473 CTCCTAATGATTCCCTCCTCAGG + Intergenic
1087585964 11:100122021-100122043 CCCCTAATAAATCCTCTATCTGG - Intronic
1087935241 11:104026117-104026139 CACCTGATGAATACTGTATCAGG + Intronic
1088733890 11:112709212-112709234 CTCCTAAGGATTCTTCTTTCTGG + Intergenic
1090460566 11:126888017-126888039 GTCCTATTGATTCCTGTTTATGG - Intronic
1095635449 12:44428071-44428093 GCCCTACTGATTCCTGCATCAGG - Intergenic
1109885434 13:68535849-68535871 TTTCTAATGATTCCAATATCTGG - Intergenic
1110017652 13:70428205-70428227 CACCCAATGATTGATGTATCTGG - Intergenic
1117494886 14:56293353-56293375 CTACTAATGATTGCTAAATCAGG + Intronic
1118855485 14:69618619-69618641 CTTCTCTGGATTCCTGTATCTGG + Intronic
1124148546 15:27155679-27155701 CTCCTAATCATTGCTGGATAGGG + Intronic
1125100228 15:35903853-35903875 CTCAAAATGTTGCCTGTATCTGG + Intergenic
1125370961 15:38975802-38975824 CTCCTAATGCTTACTGTAATTGG + Intergenic
1125476204 15:40049748-40049770 CTCCTTACAATTCCTGTAACTGG + Intergenic
1125622997 15:41081447-41081469 CTCCTAATGATTCCTGTATCTGG - Intronic
1126756547 15:51930877-51930899 ATCCTAGTGATTCCTGCCTCTGG + Intronic
1128081142 15:64857615-64857637 CTCCTAAGGAACCCTGTATCTGG - Intronic
1128873777 15:71185195-71185217 CTTATAAGGAATCCTGTATCTGG - Intronic
1131441090 15:92460334-92460356 CTCCAGATGATTCCAGTATGTGG + Intronic
1134394837 16:13853347-13853369 CTCCTAATGTTTACAGCATCTGG + Intergenic
1139026974 16:62830031-62830053 CTTCTAATTGTTCCTTTATCAGG + Intergenic
1140962020 16:79924682-79924704 CTGGTTATGATTCCTTTATCAGG - Intergenic
1142717920 17:1757207-1757229 CTCCTTCTGTTTTCTGTATCTGG - Intergenic
1147648467 17:42048578-42048600 CTCCCAATCATCCCTGTCTCAGG + Intronic
1149197286 17:54136240-54136262 CTGCAAATAATTCCTGTTTCAGG + Intergenic
1149346948 17:55748489-55748511 TTCCTAATGATGCCTGTGCCTGG - Intergenic
1149600709 17:57891395-57891417 TTCCAAATGATTTCTGAATCTGG + Intronic
1149877747 17:60254755-60254777 CTCCTTATGATTCATCTTTCTGG + Intronic
1150499653 17:65638253-65638275 CTGTTAAAGATGCCTGTATCAGG + Intronic
1156014696 18:32534360-32534382 CACCTAATGAATACTGTAGCAGG - Intergenic
931037713 2:58261749-58261771 CTACGAATGATTCATGAATCGGG + Intergenic
936249510 2:110857062-110857084 CTCTTAATGATTCCTGAAGTGGG + Intronic
937101134 2:119270319-119270341 TTTGTAAAGATTCCTGTATCTGG + Intergenic
939615261 2:144355254-144355276 CTCCTAATGATGCCTGTCCAAGG - Intergenic
942704011 2:178747519-178747541 GACCTAGTGATTCCTGTTTCTGG + Intronic
943492774 2:188577035-188577057 TTCCTCTTGATTCTTGTATCTGG + Intronic
945149382 2:206772463-206772485 CTCCTTATTATTCCTGTCTGGGG + Intronic
1174592458 20:51657183-51657205 CTCCAAATCATTCCTGCCTCTGG - Intronic
1175178466 20:57128123-57128145 GTGCTTATCATTCCTGTATCAGG - Intergenic
950156106 3:10722893-10722915 CTCTAAATGATTCATGTGTCAGG - Intergenic
952519633 3:34143740-34143762 TTCCTAATGGTCCCTGTTTCTGG + Intergenic
953562669 3:44005407-44005429 GTCATAATGACTGCTGTATCAGG - Intergenic
956295318 3:67705590-67705612 CCCCTAATGAATCCTGTTCCTGG - Intergenic
957232022 3:77531887-77531909 CTCTTAATGTTTCCTGCACCTGG + Intronic
964431777 3:156614833-156614855 CTCCTACTGATTCCTCAATAGGG + Intergenic
965513333 3:169593415-169593437 CCCCTAATGGTTCCTCTATTGGG - Intronic
965645338 3:170874234-170874256 CTCTTGGGGATTCCTGTATCTGG - Intergenic
973291216 4:48472549-48472571 CTCATTATGCTTCCTGAATCTGG + Intergenic
977243185 4:94598925-94598947 CACCAACTGATTCCTGTCTCAGG - Intronic
977898476 4:102391861-102391883 CTCCTAATCAATCGTGTATAGGG + Intronic
980136479 4:128863180-128863202 CGCCTCATTATTCCTGTAGCAGG - Intronic
986107556 5:4674353-4674375 CTACTAATGGTTCCTGTAAAGGG + Intergenic
986890074 5:12292568-12292590 CTCCTAATGATTTCTCCACCTGG + Intergenic
989234639 5:39132220-39132242 CTGCTCATGATTCCTGGCTCAGG - Intronic
994502468 5:100597118-100597140 GTCCTAATGAATTCTATATCAGG - Intergenic
1003130862 6:3394317-3394339 CTCACAATAATTCCTGTATGTGG + Intronic
1008283702 6:49624689-49624711 CTCCTCATGTCTCCAGTATCTGG + Intronic
1008620231 6:53264199-53264221 CTCATACTGGTTCCTGTATGTGG + Intergenic
1010042175 6:71397787-71397809 CTCCTCATGACTTCTGTCTCAGG + Intergenic
1011938714 6:92815268-92815290 CTCTTAGTGATTCCTTTATTGGG - Intergenic
1016970760 6:149760156-149760178 TTCTTAATGCTTACTGTATCAGG + Intronic
1017273553 6:152538486-152538508 ATCTTAATGATGACTGTATCTGG + Intronic
1018756696 6:166855907-166855929 TTCCTGATGCTTACTGTATCTGG - Intronic
1029824429 7:103174261-103174283 CTCCTGGTTATTCCTGTGTCCGG + Intergenic
1031982570 7:128137070-128137092 CTCACAATGATTCCTGTGGCAGG - Intergenic
1035224222 7:157424794-157424816 CTCCTAATGAGGCGGGTATCTGG + Intergenic
1039231581 8:35454477-35454499 CTCCTCCTCTTTCCTGTATCAGG + Intronic
1039682241 8:39753063-39753085 CTCCAAATGATTCCAATCTCTGG - Intronic
1040427650 8:47304822-47304844 CTTTTAATGGTTCCTGTATTAGG + Intronic
1040908403 8:52492337-52492359 CTTCTGTTGATCCCTGTATCTGG + Intergenic
1041960857 8:63614072-63614094 CTGGTCATGATTTCTGTATCTGG - Intergenic
1044238748 8:89863554-89863576 CTCCTAATGACTTCGGTTTCTGG - Intergenic
1047078501 8:121432661-121432683 CTCTTAATTATTCATATATCTGG + Intergenic
1047873328 8:129108748-129108770 CTTCCAATGTTTCCTGTATTTGG + Intergenic
1052839912 9:33284071-33284093 CTGCTAATTCTTCCTGTATTGGG + Intergenic
1058295288 9:103298844-103298866 CTCCTACTGGTTCCTCTGTCTGG - Intergenic
1192901586 X:75504171-75504193 CTTATAATGATTCCTGTACTGGG - Intronic
1200235334 X:154465321-154465343 CTGCTAGGGATTCCTGTACCTGG + Intronic