ID: 1125626832

View in Genome Browser
Species Human (GRCh38)
Location 15:41115988-41116010
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 281}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125626832_1125626855 12 Left 1125626832 15:41115988-41116010 CCCGCCGCCGCGACGGCGGCGGA 0: 1
1: 0
2: 0
3: 22
4: 281
Right 1125626855 15:41116023-41116045 TGCGGGCGGGGTCCGGAGGGGGG 0: 1
1: 0
2: 3
3: 30
4: 474
1125626832_1125626845 -6 Left 1125626832 15:41115988-41116010 CCCGCCGCCGCGACGGCGGCGGA 0: 1
1: 0
2: 0
3: 22
4: 281
Right 1125626845 15:41116005-41116027 GGCGGAGGGGGGGCGGGGTGCGG 0: 1
1: 3
2: 45
3: 620
4: 4589
1125626832_1125626856 13 Left 1125626832 15:41115988-41116010 CCCGCCGCCGCGACGGCGGCGGA 0: 1
1: 0
2: 0
3: 22
4: 281
Right 1125626856 15:41116024-41116046 GCGGGCGGGGTCCGGAGGGGGGG 0: 1
1: 1
2: 6
3: 85
4: 759
1125626832_1125626851 8 Left 1125626832 15:41115988-41116010 CCCGCCGCCGCGACGGCGGCGGA 0: 1
1: 0
2: 0
3: 22
4: 281
Right 1125626851 15:41116019-41116041 GGGGTGCGGGCGGGGTCCGGAGG 0: 1
1: 0
2: 6
3: 110
4: 1014
1125626832_1125626859 29 Left 1125626832 15:41115988-41116010 CCCGCCGCCGCGACGGCGGCGGA 0: 1
1: 0
2: 0
3: 22
4: 281
Right 1125626859 15:41116040-41116062 GGGGGGGGTCGCCCCGCCGACGG 0: 1
1: 0
2: 0
3: 14
4: 77
1125626832_1125626850 5 Left 1125626832 15:41115988-41116010 CCCGCCGCCGCGACGGCGGCGGA 0: 1
1: 0
2: 0
3: 22
4: 281
Right 1125626850 15:41116016-41116038 GGCGGGGTGCGGGCGGGGTCCGG 0: 1
1: 1
2: 17
3: 199
4: 1439
1125626832_1125626853 10 Left 1125626832 15:41115988-41116010 CCCGCCGCCGCGACGGCGGCGGA 0: 1
1: 0
2: 0
3: 22
4: 281
Right 1125626853 15:41116021-41116043 GGTGCGGGCGGGGTCCGGAGGGG 0: 1
1: 1
2: 2
3: 59
4: 459
1125626832_1125626852 9 Left 1125626832 15:41115988-41116010 CCCGCCGCCGCGACGGCGGCGGA 0: 1
1: 0
2: 0
3: 22
4: 281
Right 1125626852 15:41116020-41116042 GGGTGCGGGCGGGGTCCGGAGGG 0: 1
1: 0
2: 4
3: 49
4: 407
1125626832_1125626846 -5 Left 1125626832 15:41115988-41116010 CCCGCCGCCGCGACGGCGGCGGA 0: 1
1: 0
2: 0
3: 22
4: 281
Right 1125626846 15:41116006-41116028 GCGGAGGGGGGGCGGGGTGCGGG 0: 1
1: 2
2: 8
3: 235
4: 1989
1125626832_1125626857 14 Left 1125626832 15:41115988-41116010 CCCGCCGCCGCGACGGCGGCGGA 0: 1
1: 0
2: 0
3: 22
4: 281
Right 1125626857 15:41116025-41116047 CGGGCGGGGTCCGGAGGGGGGGG 0: 1
1: 0
2: 12
3: 91
4: 791
1125626832_1125626848 -1 Left 1125626832 15:41115988-41116010 CCCGCCGCCGCGACGGCGGCGGA 0: 1
1: 0
2: 0
3: 22
4: 281
Right 1125626848 15:41116010-41116032 AGGGGGGGCGGGGTGCGGGCGGG 0: 1
1: 0
2: 17
3: 264
4: 2033
1125626832_1125626847 -2 Left 1125626832 15:41115988-41116010 CCCGCCGCCGCGACGGCGGCGGA 0: 1
1: 0
2: 0
3: 22
4: 281
Right 1125626847 15:41116009-41116031 GAGGGGGGGCGGGGTGCGGGCGG 0: 1
1: 2
2: 38
3: 500
4: 3809
1125626832_1125626854 11 Left 1125626832 15:41115988-41116010 CCCGCCGCCGCGACGGCGGCGGA 0: 1
1: 0
2: 0
3: 22
4: 281
Right 1125626854 15:41116022-41116044 GTGCGGGCGGGGTCCGGAGGGGG 0: 1
1: 0
2: 3
3: 39
4: 414
1125626832_1125626849 0 Left 1125626832 15:41115988-41116010 CCCGCCGCCGCGACGGCGGCGGA 0: 1
1: 0
2: 0
3: 22
4: 281
Right 1125626849 15:41116011-41116033 GGGGGGGCGGGGTGCGGGCGGGG 0: 1
1: 3
2: 58
3: 599
4: 4071

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125626832 Original CRISPR TCCGCCGCCGTCGCGGCGGC GGG (reversed) Exonic