ID: 1125626856

View in Genome Browser
Species Human (GRCh38)
Location 15:41116024-41116046
Sequence GCGGGCGGGGTCCGGAGGGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 852
Summary {0: 1, 1: 1, 2: 6, 3: 85, 4: 759}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125626830_1125626856 14 Left 1125626830 15:41115987-41116009 CCCCGCCGCCGCGACGGCGGCGG 0: 1
1: 0
2: 2
3: 53
4: 432
Right 1125626856 15:41116024-41116046 GCGGGCGGGGTCCGGAGGGGGGG 0: 1
1: 1
2: 6
3: 85
4: 759
1125626832_1125626856 13 Left 1125626832 15:41115988-41116010 CCCGCCGCCGCGACGGCGGCGGA 0: 1
1: 0
2: 0
3: 22
4: 281
Right 1125626856 15:41116024-41116046 GCGGGCGGGGTCCGGAGGGGGGG 0: 1
1: 1
2: 6
3: 85
4: 759
1125626826_1125626856 22 Left 1125626826 15:41115979-41116001 CCGCCTGGCCCCGCCGCCGCGAC 0: 1
1: 0
2: 3
3: 55
4: 458
Right 1125626856 15:41116024-41116046 GCGGGCGGGGTCCGGAGGGGGGG 0: 1
1: 1
2: 6
3: 85
4: 759
1125626825_1125626856 29 Left 1125626825 15:41115972-41115994 CCTCGGGCCGCCTGGCCCCGCCG 0: 1
1: 0
2: 2
3: 64
4: 525
Right 1125626856 15:41116024-41116046 GCGGGCGGGGTCCGGAGGGGGGG 0: 1
1: 1
2: 6
3: 85
4: 759
1125626828_1125626856 19 Left 1125626828 15:41115982-41116004 CCTGGCCCCGCCGCCGCGACGGC 0: 1
1: 0
2: 6
3: 91
4: 646
Right 1125626856 15:41116024-41116046 GCGGGCGGGGTCCGGAGGGGGGG 0: 1
1: 1
2: 6
3: 85
4: 759
1125626836_1125626856 9 Left 1125626836 15:41115992-41116014 CCGCCGCGACGGCGGCGGAGGGG 0: 1
1: 0
2: 4
3: 37
4: 303
Right 1125626856 15:41116024-41116046 GCGGGCGGGGTCCGGAGGGGGGG 0: 1
1: 1
2: 6
3: 85
4: 759
1125626840_1125626856 6 Left 1125626840 15:41115995-41116017 CCGCGACGGCGGCGGAGGGGGGG 0: 1
1: 0
2: 2
3: 43
4: 506
Right 1125626856 15:41116024-41116046 GCGGGCGGGGTCCGGAGGGGGGG 0: 1
1: 1
2: 6
3: 85
4: 759
1125626833_1125626856 12 Left 1125626833 15:41115989-41116011 CCGCCGCCGCGACGGCGGCGGAG 0: 1
1: 0
2: 1
3: 44
4: 318
Right 1125626856 15:41116024-41116046 GCGGGCGGGGTCCGGAGGGGGGG 0: 1
1: 1
2: 6
3: 85
4: 759

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125626856 Original CRISPR GCGGGCGGGGTCCGGAGGGG GGG Exonic