ID: 1125626859

View in Genome Browser
Species Human (GRCh38)
Location 15:41116040-41116062
Sequence GGGGGGGGTCGCCCCGCCGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 77}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125626832_1125626859 29 Left 1125626832 15:41115988-41116010 CCCGCCGCCGCGACGGCGGCGGA 0: 1
1: 0
2: 0
3: 22
4: 281
Right 1125626859 15:41116040-41116062 GGGGGGGGTCGCCCCGCCGACGG 0: 1
1: 0
2: 0
3: 14
4: 77
1125626833_1125626859 28 Left 1125626833 15:41115989-41116011 CCGCCGCCGCGACGGCGGCGGAG 0: 1
1: 0
2: 1
3: 44
4: 318
Right 1125626859 15:41116040-41116062 GGGGGGGGTCGCCCCGCCGACGG 0: 1
1: 0
2: 0
3: 14
4: 77
1125626836_1125626859 25 Left 1125626836 15:41115992-41116014 CCGCCGCGACGGCGGCGGAGGGG 0: 1
1: 0
2: 4
3: 37
4: 303
Right 1125626859 15:41116040-41116062 GGGGGGGGTCGCCCCGCCGACGG 0: 1
1: 0
2: 0
3: 14
4: 77
1125626840_1125626859 22 Left 1125626840 15:41115995-41116017 CCGCGACGGCGGCGGAGGGGGGG 0: 1
1: 0
2: 2
3: 43
4: 506
Right 1125626859 15:41116040-41116062 GGGGGGGGTCGCCCCGCCGACGG 0: 1
1: 0
2: 0
3: 14
4: 77
1125626830_1125626859 30 Left 1125626830 15:41115987-41116009 CCCCGCCGCCGCGACGGCGGCGG 0: 1
1: 0
2: 2
3: 53
4: 432
Right 1125626859 15:41116040-41116062 GGGGGGGGTCGCCCCGCCGACGG 0: 1
1: 0
2: 0
3: 14
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125626859 Original CRISPR GGGGGGGGTCGCCCCGCCGA CGG Exonic