ID: 1125626859

View in Genome Browser
Species Human (GRCh38)
Location 15:41116040-41116062
Sequence GGGGGGGGTCGCCCCGCCGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 77}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125626836_1125626859 25 Left 1125626836 15:41115992-41116014 CCGCCGCGACGGCGGCGGAGGGG 0: 1
1: 0
2: 4
3: 37
4: 303
Right 1125626859 15:41116040-41116062 GGGGGGGGTCGCCCCGCCGACGG 0: 1
1: 0
2: 0
3: 14
4: 77
1125626832_1125626859 29 Left 1125626832 15:41115988-41116010 CCCGCCGCCGCGACGGCGGCGGA 0: 1
1: 0
2: 0
3: 22
4: 281
Right 1125626859 15:41116040-41116062 GGGGGGGGTCGCCCCGCCGACGG 0: 1
1: 0
2: 0
3: 14
4: 77
1125626840_1125626859 22 Left 1125626840 15:41115995-41116017 CCGCGACGGCGGCGGAGGGGGGG 0: 1
1: 0
2: 2
3: 43
4: 506
Right 1125626859 15:41116040-41116062 GGGGGGGGTCGCCCCGCCGACGG 0: 1
1: 0
2: 0
3: 14
4: 77
1125626833_1125626859 28 Left 1125626833 15:41115989-41116011 CCGCCGCCGCGACGGCGGCGGAG 0: 1
1: 0
2: 1
3: 44
4: 318
Right 1125626859 15:41116040-41116062 GGGGGGGGTCGCCCCGCCGACGG 0: 1
1: 0
2: 0
3: 14
4: 77
1125626830_1125626859 30 Left 1125626830 15:41115987-41116009 CCCCGCCGCCGCGACGGCGGCGG 0: 1
1: 0
2: 2
3: 53
4: 432
Right 1125626859 15:41116040-41116062 GGGGGGGGTCGCCCCGCCGACGG 0: 1
1: 0
2: 0
3: 14
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125626859 Original CRISPR GGGGGGGGTCGCCCCGCCGA CGG Exonic
901443613 1:9293539-9293561 GGGTGGGGGCGCCCCGACGGGGG - Intronic
902375075 1:16026767-16026789 GAGGGGGGTCTCACCGCTGAAGG - Exonic
903829129 1:26164432-26164454 GAGGGGGGTCGCGCCGCCAGAGG + Intergenic
906761884 1:48383465-48383487 GGGGGGGGTCAGCCCCCCGCCGG - Intronic
910277531 1:85464998-85465020 GGCGTGGGTGGCCCGGCCGAAGG + Exonic
914790951 1:150876742-150876764 AGGCGGGGTCTCCCCGCCGCAGG - Exonic
920385652 1:205568937-205568959 GGGAGGGGCCGCCCCAGCGAGGG - Intronic
920385763 1:205569347-205569369 GGGAAGGGTCGGCCCGGCGAGGG - Intronic
1069052552 10:63811303-63811325 GGGGGGGCTGGCCCGGCAGAGGG + Intergenic
1073136326 10:101222534-101222556 GGGGGGGGTCCCCGCGGCGACGG + Intergenic
1076650396 10:131982751-131982773 GGGGTGGGACGCCCCGTCCACGG + Intergenic
1083291254 11:61691522-61691544 GGGGGGGGTCCCACCTCCAAAGG - Intronic
1097871984 12:64610050-64610072 GGTGGGGGTTGCCCGGCCGAGGG - Intergenic
1101910559 12:108857633-108857655 GGGGGCGGTGGCGACGCCGAGGG - Intergenic
1102014607 12:109639544-109639566 GGGGAGAGTCAGCCCGCCGAGGG + Intergenic
1103362363 12:120361722-120361744 GGCGGGGGGCCCCCCGCCGCGGG + Intronic
1104259055 12:127166129-127166151 GGGGCGGGGCGGCCCGCCGGCGG + Intergenic
1106269371 13:28138732-28138754 GGCGGTGGTGGCCCCGCCGGGGG + Exonic
1108478561 13:50843979-50844001 GGGCGGGGTATCCCCGCCGATGG - Intergenic
1108688916 13:52845773-52845795 GGAGGGGGGCGCCCAGCCGAAGG + Intronic
1113200965 13:107867252-107867274 GGGAGGGAGCGCCCCGCCGGAGG - Intergenic
1113480347 13:110615807-110615829 CGGGGGGGAAGCGCCGCCGAGGG + Intronic
1115592188 14:34874898-34874920 GGGGCAGGACGCCCCGCCGCGGG + Intronic
1117315481 14:54567383-54567405 GGGAGGGGGCGTCCCGCGGAAGG - Intronic
1118854623 14:69611554-69611576 GGCGGGGGAGGCCCCGCGGAGGG - Intergenic
1124904742 15:33857946-33857968 GGGCGGGGTGGCCCCGCAGTGGG - Intronic
1125626859 15:41116040-41116062 GGGGGGGGTCGCCCCGCCGACGG + Exonic
1128321993 15:66701080-66701102 GGGGCGGGGCGCCGCGCCGGGGG + Intergenic
1128970186 15:72100870-72100892 GGGGGGGGTCAGCCCCCCGCCGG + Intronic
1132850622 16:2023385-2023407 GGGCGGGGTCGCCCCGTCGGCGG + Intergenic
1132853576 16:2035234-2035256 GGGGGGGACCGCCCCGCCAAGGG - Intronic
1132942316 16:2514321-2514343 GGCGGGGGTCGGCGCCCCGAGGG + Intronic
1135429863 16:22374204-22374226 GGGCGGGGGCGCCCCGCGGGCGG - Intronic
1136426277 16:30170101-30170123 TGGGGGGGTCGGCCCCCCGCCGG + Intergenic
1142418771 16:89957665-89957687 GTGTGGGGCCGCCCCGCCGTGGG + Intronic
1152636468 17:81432563-81432585 GGGGAGGGTGGGCCCGGCGATGG - Intronic
1152924479 17:83080847-83080869 GGGGGCGGGGGCCGCGCCGAGGG - Intronic
1155249530 18:23941313-23941335 GGGGGGGGGCGCCAAGCTGATGG - Intronic
1158505538 18:58044024-58044046 GGCGGGGGTCACCCGGCCGCGGG - Intergenic
1160870370 19:1275166-1275188 GGCGGGGGTCGCCCCGAAGTGGG + Intergenic
1161175807 19:2841663-2841685 GCGGGGGGCGGCCCCGGCGAGGG + Intronic
1162535791 19:11262322-11262344 GGGGAGGGTCGCACCGCCCCGGG + Intronic
1164161318 19:22627313-22627335 GGGGGAGGTAGCCCCCCCCATGG - Intergenic
1165331342 19:35142632-35142654 GCGGGGAGTTGCCCCGCCGCGGG + Intronic
937339873 2:121084323-121084345 GGGGGCGGTGGCACCGCCAAGGG + Intergenic
942505558 2:176637995-176638017 GGGACTGGCCGCCCCGCCGAAGG - Intergenic
948874538 2:240819788-240819810 GGGAGGGCTCGCCCGGCCGGCGG - Intronic
948874776 2:240820574-240820596 GGTGGGGGACGGCCCGGCGAGGG - Intergenic
1172118626 20:32585204-32585226 GGGGCGGGCCGCCCCGCGGGCGG + Intronic
1176550422 21:8218656-8218678 AGGGGGGGGCGGCCCGCCGGCGG - Intergenic
1176569350 21:8401694-8401716 GGGGGGGGGCGGCCCGCCGGCGG - Intergenic
1176577264 21:8445926-8445948 AGGGGGGGGCGGCCCGCCGGCGG - Intergenic
1181043542 22:20204100-20204122 GGGGTGGGTGGCTCTGCCGAGGG + Intergenic
1183294141 22:37019810-37019832 GGGAGGGGGCGCCGCGCCGCGGG + Intronic
1183395010 22:37566621-37566643 GGGTGGGGGCGCCCCCCCGGAGG + Exonic
1183484750 22:38082837-38082859 GGGGGCCCTCGCCCCGCCGGGGG + Exonic
1184846482 22:47090853-47090875 GGGGGGAGTGGCCTCGCAGAGGG + Intronic
1184846521 22:47091045-47091067 GGGGGGAGTGGCCTCGCAGAGGG + Intronic
1184846576 22:47091350-47091372 GGGGGGAGTGGCCTCGCAGAGGG + Intronic
1203255317 22_KI270733v1_random:134994-135016 GGGGGGGGGCGGCCCGCCGGCGG - Intergenic
950438510 3:12994219-12994241 CGGGGAGGCCGCCCCGCCGGTGG - Intronic
950677681 3:14564452-14564474 GGGAGGGGACGGCCTGCCGAGGG + Intergenic
950940409 3:16885151-16885173 GGGGGAGGTCGCCTCGGCCACGG + Intronic
952887207 3:38019068-38019090 GGGGAGGATCACCCCACCGAGGG - Intronic
954200719 3:49021785-49021807 GTGGGCGGTCGCCCCGCCCCGGG + Exonic
967892552 3:194373218-194373240 GGAGGGGTTTGCCCCACCGAGGG - Intergenic
968287864 3:197518783-197518805 GGGGGGGGTCGGCCTGAGGAGGG - Intronic
984639301 4:182144625-182144647 GGGGAGGGGGGCCCCGCCGAGGG - Intronic
995193539 5:109342000-109342022 TGGGGGGGTCGGCCCCCCGCCGG + Intronic
997177723 5:131796793-131796815 GGCGGGGGTCGCGGAGCCGATGG - Intronic
1002316903 5:178349526-178349548 GTGGGGGGTGGCCCTGCCTAGGG - Intronic
1004424179 6:15496609-15496631 GGGGCGGCTGGCCCCGCCGAAGG + Exonic
1004562001 6:16760660-16760682 GGCGGGGGTCTCCCCTCGGAGGG - Intronic
1006677806 6:35776740-35776762 GGAGAGGGTGGCCCCGCCGCCGG + Intronic
1013272556 6:108558097-108558119 GGCGGGGCGCGACCCGCCGAGGG - Intergenic
1016923410 6:149317733-149317755 GGGCTGGGTCGCCCCGCCGGCGG - Intronic
1018966641 6:168495261-168495283 GAGGGGGGTGGACCCGCAGAGGG - Intronic
1019714977 7:2534411-2534433 GGGGGGGGTCAGCCCCCCGCCGG - Intergenic
1025712472 7:63925806-63925828 GGGTGGGGTCGACCCGGCGGGGG + Intergenic
1029123094 7:98281447-98281469 GGGGGGGGTCTCCCCGCCACGGG + Intronic
1034188215 7:149195450-149195472 GGGGCGGGGAGCGCCGCCGAAGG + Intergenic
1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG + Intronic
1039591989 8:38757196-38757218 GGGGTGGGGCGCCCGGCCGTAGG - Intronic
1039964042 8:42271186-42271208 CGGGGGAGTCGCCCGGTCGAGGG + Intergenic
1057199947 9:93134453-93134475 GGGAGGGGGCGCGACGCCGATGG + Intergenic
1057995727 9:99820531-99820553 GGCGGGGGGCGCTGCGCCGAGGG - Intergenic
1062260457 9:135660146-135660168 GGCGGGGGTCGCCCATCCAAGGG + Intergenic
1203471715 Un_GL000220v1:118131-118153 GGGGGGGGGCGGCCCGCCGGCGG - Intergenic
1190337243 X:49269956-49269978 GGCGGCGGTGGCCCCGCGGAGGG + Exonic
1192274524 X:69616070-69616092 GGGGAGGCTCGGCCCGCCGAGGG - Exonic
1196707346 X:118727704-118727726 GGGCGGGGGCGCCGCGCCTACGG + Exonic
1198276482 X:135098954-135098976 GGGCGGGGCCGCTACGCCGACGG - Intergenic