ID: 1125626860 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:41116043-41116065 |
Sequence | GGGGGTCGCCCCGCCGACGG TGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 73 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 69} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1125626836_1125626860 | 28 | Left | 1125626836 | 15:41115992-41116014 | CCGCCGCGACGGCGGCGGAGGGG | 0: 1 1: 0 2: 4 3: 37 4: 303 |
||
Right | 1125626860 | 15:41116043-41116065 | GGGGGTCGCCCCGCCGACGGTGG | 0: 1 1: 0 2: 0 3: 3 4: 69 |
||||
1125626840_1125626860 | 25 | Left | 1125626840 | 15:41115995-41116017 | CCGCGACGGCGGCGGAGGGGGGG | 0: 1 1: 0 2: 2 3: 43 4: 506 |
||
Right | 1125626860 | 15:41116043-41116065 | GGGGGTCGCCCCGCCGACGGTGG | 0: 1 1: 0 2: 0 3: 3 4: 69 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1125626860 | Original CRISPR | GGGGGTCGCCCCGCCGACGG TGG | Exonic | ||