ID: 1125630258

View in Genome Browser
Species Human (GRCh38)
Location 15:41141567-41141589
Sequence GGTTAGTTCTTACCTCTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125630258_1125630267 12 Left 1125630258 15:41141567-41141589 CCTGTAAGAGGTAAGAACTAACC No data
Right 1125630267 15:41141602-41141624 GCCTCTAAAGTCCAAACTGGGGG No data
1125630258_1125630266 11 Left 1125630258 15:41141567-41141589 CCTGTAAGAGGTAAGAACTAACC No data
Right 1125630266 15:41141601-41141623 TGCCTCTAAAGTCCAAACTGGGG No data
1125630258_1125630270 25 Left 1125630258 15:41141567-41141589 CCTGTAAGAGGTAAGAACTAACC No data
Right 1125630270 15:41141615-41141637 AAACTGGGGGTTCTCTCTCTTGG No data
1125630258_1125630265 10 Left 1125630258 15:41141567-41141589 CCTGTAAGAGGTAAGAACTAACC No data
Right 1125630265 15:41141600-41141622 TTGCCTCTAAAGTCCAAACTGGG No data
1125630258_1125630264 9 Left 1125630258 15:41141567-41141589 CCTGTAAGAGGTAAGAACTAACC No data
Right 1125630264 15:41141599-41141621 CTTGCCTCTAAAGTCCAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125630258 Original CRISPR GGTTAGTTCTTACCTCTTAC AGG (reversed) Intergenic