ID: 1125630264 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:41141599-41141621 |
Sequence | CTTGCCTCTAAAGTCCAAAC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1125630257_1125630264 | 10 | Left | 1125630257 | 15:41141566-41141588 | CCCTGTAAGAGGTAAGAACTAAC | No data | ||
Right | 1125630264 | 15:41141599-41141621 | CTTGCCTCTAAAGTCCAAACTGG | No data | ||||
1125630258_1125630264 | 9 | Left | 1125630258 | 15:41141567-41141589 | CCTGTAAGAGGTAAGAACTAACC | No data | ||
Right | 1125630264 | 15:41141599-41141621 | CTTGCCTCTAAAGTCCAAACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1125630264 | Original CRISPR | CTTGCCTCTAAAGTCCAAAC TGG | Intergenic | ||