ID: 1125630265

View in Genome Browser
Species Human (GRCh38)
Location 15:41141600-41141622
Sequence TTGCCTCTAAAGTCCAAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125630257_1125630265 11 Left 1125630257 15:41141566-41141588 CCCTGTAAGAGGTAAGAACTAAC No data
Right 1125630265 15:41141600-41141622 TTGCCTCTAAAGTCCAAACTGGG No data
1125630258_1125630265 10 Left 1125630258 15:41141567-41141589 CCTGTAAGAGGTAAGAACTAACC No data
Right 1125630265 15:41141600-41141622 TTGCCTCTAAAGTCCAAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125630265 Original CRISPR TTGCCTCTAAAGTCCAAACT GGG Intergenic
No off target data available for this crispr