ID: 1125630270

View in Genome Browser
Species Human (GRCh38)
Location 15:41141615-41141637
Sequence AAACTGGGGGTTCTCTCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125630259_1125630270 4 Left 1125630259 15:41141588-41141610 CCAACCCCCATCTTGCCTCTAAA No data
Right 1125630270 15:41141615-41141637 AAACTGGGGGTTCTCTCTCTTGG No data
1125630258_1125630270 25 Left 1125630258 15:41141567-41141589 CCTGTAAGAGGTAAGAACTAACC No data
Right 1125630270 15:41141615-41141637 AAACTGGGGGTTCTCTCTCTTGG No data
1125630260_1125630270 0 Left 1125630260 15:41141592-41141614 CCCCCATCTTGCCTCTAAAGTCC No data
Right 1125630270 15:41141615-41141637 AAACTGGGGGTTCTCTCTCTTGG No data
1125630257_1125630270 26 Left 1125630257 15:41141566-41141588 CCCTGTAAGAGGTAAGAACTAAC No data
Right 1125630270 15:41141615-41141637 AAACTGGGGGTTCTCTCTCTTGG No data
1125630262_1125630270 -2 Left 1125630262 15:41141594-41141616 CCCATCTTGCCTCTAAAGTCCAA No data
Right 1125630270 15:41141615-41141637 AAACTGGGGGTTCTCTCTCTTGG No data
1125630263_1125630270 -3 Left 1125630263 15:41141595-41141617 CCATCTTGCCTCTAAAGTCCAAA No data
Right 1125630270 15:41141615-41141637 AAACTGGGGGTTCTCTCTCTTGG No data
1125630261_1125630270 -1 Left 1125630261 15:41141593-41141615 CCCCATCTTGCCTCTAAAGTCCA No data
Right 1125630270 15:41141615-41141637 AAACTGGGGGTTCTCTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125630270 Original CRISPR AAACTGGGGGTTCTCTCTCT TGG Intergenic
No off target data available for this crispr