ID: 1125630813

View in Genome Browser
Species Human (GRCh38)
Location 15:41145586-41145608
Sequence CCTTTCTTTTAGAAGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125630810_1125630813 -8 Left 1125630810 15:41145571-41145593 CCTAACAAATGATGCCCTTTCTT No data
Right 1125630813 15:41145586-41145608 CCTTTCTTTTAGAAGAGTGAAGG No data
1125630809_1125630813 6 Left 1125630809 15:41145557-41145579 CCATGGAAAAAGGACCTAACAAA 0: 39
1: 40
2: 27
3: 29
4: 254
Right 1125630813 15:41145586-41145608 CCTTTCTTTTAGAAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125630813 Original CRISPR CCTTTCTTTTAGAAGAGTGA AGG Intergenic
No off target data available for this crispr