ID: 1125633488

View in Genome Browser
Species Human (GRCh38)
Location 15:41167803-41167825
Sequence GATCCTCCCACTTCAGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125633488_1125633492 -1 Left 1125633488 15:41167803-41167825 CCAGCTACTGAAGTGGGAGGATC No data
Right 1125633492 15:41167825-41167847 CACTTAACCCCAGAGGGTGGAGG No data
1125633488_1125633490 -7 Left 1125633488 15:41167803-41167825 CCAGCTACTGAAGTGGGAGGATC No data
Right 1125633490 15:41167819-41167841 GAGGATCACTTAACCCCAGAGGG No data
1125633488_1125633491 -4 Left 1125633488 15:41167803-41167825 CCAGCTACTGAAGTGGGAGGATC No data
Right 1125633491 15:41167822-41167844 GATCACTTAACCCCAGAGGGTGG No data
1125633488_1125633489 -8 Left 1125633488 15:41167803-41167825 CCAGCTACTGAAGTGGGAGGATC No data
Right 1125633489 15:41167818-41167840 GGAGGATCACTTAACCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125633488 Original CRISPR GATCCTCCCACTTCAGTAGC TGG (reversed) Intergenic