ID: 1125633489

View in Genome Browser
Species Human (GRCh38)
Location 15:41167818-41167840
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125633483_1125633489 1 Left 1125633483 15:41167794-41167816 CCTGTGGTCCCAGCTACTGAAGT No data
Right 1125633489 15:41167818-41167840 GGAGGATCACTTAACCCCAGAGG No data
1125633487_1125633489 -7 Left 1125633487 15:41167802-41167824 CCCAGCTACTGAAGTGGGAGGAT No data
Right 1125633489 15:41167818-41167840 GGAGGATCACTTAACCCCAGAGG No data
1125633488_1125633489 -8 Left 1125633488 15:41167803-41167825 CCAGCTACTGAAGTGGGAGGATC No data
Right 1125633489 15:41167818-41167840 GGAGGATCACTTAACCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125633489 Original CRISPR GGAGGATCACTTAACCCCAG AGG Intergenic