ID: 1125637718

View in Genome Browser
Species Human (GRCh38)
Location 15:41203413-41203435
Sequence GAGTCTCAACAAAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 237}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125637718_1125637722 6 Left 1125637718 15:41203413-41203435 CCCTCTTCCCTTTGTTGAGACTC 0: 1
1: 0
2: 1
3: 30
4: 237
Right 1125637722 15:41203442-41203464 TAATACCCCAAAGCAAAGAAAGG 0: 1
1: 0
2: 2
3: 21
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125637718 Original CRISPR GAGTCTCAACAAAGGGAAGA GGG (reversed) Intronic
903676725 1:25068964-25068986 GAGCCTCCACATAGGGAAGGTGG - Intergenic
904002701 1:27347889-27347911 GAGTCTCAGGAAGGGGGAGATGG + Intronic
904180561 1:28663816-28663838 GAGCCTTAACAAAGGAATGAAGG + Intergenic
904513860 1:31037700-31037722 CAGTCTCAAAAAAAGAAAGAAGG + Intronic
905098298 1:35494923-35494945 GATTTTCAACAAAGGTAAAACGG + Intronic
905962091 1:42051689-42051711 GAGTCTCAACAGAGGCATTAGGG + Intergenic
906971244 1:50516569-50516591 GAGTCCCTCCAAAGTGAAGAGGG + Intronic
907624307 1:56013102-56013124 GACTCAAAATAAAGGGAAGAAGG + Intergenic
908243481 1:62208395-62208417 GGGTCTCAACAAGGGCAACAAGG - Intronic
909349987 1:74640330-74640352 GGGTGACAACAAAGGAAAGATGG + Intronic
913179127 1:116302472-116302494 GAGTCTCAGCTTAGGAAAGAGGG - Intergenic
915643940 1:157253485-157253507 GATCCTCAACATAGGGAAGGAGG + Intergenic
915745230 1:158151047-158151069 GGGTCAGAACAAAGGGAAGGGGG - Intergenic
915999244 1:160598784-160598806 GTGTCTCTTCAAAGAGAAGAAGG - Intergenic
916487947 1:165275989-165276011 GAGTTTTCACAAAGGGAAGCTGG + Intronic
917895236 1:179480728-179480750 GAGTCTTAATACAAGGAAGAGGG - Intronic
919925592 1:202190273-202190295 GGGTCTCCCCAAGGGGAAGAGGG + Intergenic
920180518 1:204129455-204129477 GTGTCTCAGCAGAGGGAATAAGG - Intergenic
920669853 1:207995218-207995240 GCGTCTAAACAAACAGAAGAAGG - Intergenic
922723674 1:227912273-227912295 CTGTCTCAAAAAAGGGAAGAAGG - Intergenic
923027789 1:230219665-230219687 AAGTCTCAAGAAAGGTAAGTGGG - Intronic
924116719 1:240754279-240754301 GAGACTGAGCAGAGGGAAGAGGG - Intergenic
924220492 1:241869818-241869840 CAGTCTCAAAAAAGGAAGGAAGG - Intronic
1063311298 10:4955198-4955220 GAGTCTCCACCAGTGGAAGACGG + Intronic
1064367155 10:14718328-14718350 GAGACTCAAGAAAGGAAGGAAGG + Intronic
1064503555 10:16003587-16003609 GATTTTCAACAAAGGGGAAAGGG + Intergenic
1064642659 10:17430051-17430073 GAGACTCAGAAAGGGGAAGATGG - Intronic
1064879071 10:20030102-20030124 ATGTCTCAACAAAGTGAAAATGG + Intronic
1067474988 10:46558939-46558961 GAGTCTCAGCAAATGGTAGTTGG - Intergenic
1069052151 10:63806723-63806745 AACTATCAACAAAGGGAAGAGGG - Intergenic
1069330973 10:67292410-67292432 GAGTCCCAACAAAGTAAAGTGGG + Intronic
1069382116 10:67851914-67851936 CTGTCTCAAAAAAAGGAAGAAGG + Intergenic
1070814970 10:79317275-79317297 GACTGTCCACAGAGGGAAGAAGG + Intergenic
1072267089 10:93741259-93741281 GGGTCTCAAGAAAGGGAAAATGG - Intergenic
1072356048 10:94612060-94612082 GAGTCTAGTCTAAGGGAAGAAGG + Intronic
1073088822 10:100914622-100914644 GAGGTTCTGCAAAGGGAAGAAGG - Intronic
1076643494 10:131935167-131935189 GAGGCTCAACAGAAAGAAGAGGG - Intronic
1080497823 11:32837896-32837918 GACTCTTAAGAAAGGGAAAAAGG - Intronic
1081590900 11:44422405-44422427 GTGTCTCAAAAAAGAAAAGAGGG - Intergenic
1082121457 11:48384210-48384232 GGGTCACAACAAAAGGAAGGAGG - Intergenic
1082555442 11:54558464-54558486 GGGTCACAACAAAAGGAAGGAGG - Intergenic
1084792923 11:71486162-71486184 GAGGCTCACCTAAGGGAAGTGGG - Intronic
1087453795 11:98357234-98357256 TAGTCTCAATAAAGGAGAGATGG + Intergenic
1087559995 11:99776599-99776621 GAGTCTCATCAAAACAAAGATGG - Intronic
1088789671 11:113213548-113213570 GAGTCTCAACGACTGGGAGAAGG - Intronic
1089813745 11:121153537-121153559 GAGCCTCAACAGACAGAAGAGGG - Intronic
1090168460 11:124576983-124577005 GAGTCTCTACCAAGTGATGATGG - Intergenic
1090727542 11:129541283-129541305 GAGTTTCAAGAAAGGAAATATGG - Intergenic
1090986898 11:131775551-131775573 TGGTGTCAACAGAGGGAAGAGGG - Intronic
1091420170 12:331478-331500 GAGTCAAAATAAAGGAAAGAAGG + Intronic
1091521644 12:1250678-1250700 TATTCTCAACTAAGGGAAGATGG - Intronic
1095774708 12:45999617-45999639 GAGACCCAAGAAAGGGGAGAGGG - Intergenic
1096140883 12:49241657-49241679 GACTCTCAAAAAAGGAAGGAAGG - Intronic
1096815793 12:54200993-54201015 AAGGCTGAACAAAGGGAAGTTGG - Intergenic
1098622342 12:72617593-72617615 GACTGTTAACATAGGGAAGAGGG - Intronic
1098790660 12:74817549-74817571 GTGTCTCGACAAAGGGAACACGG - Intergenic
1099286442 12:80718139-80718161 GAGCAGCAGCAAAGGGAAGAGGG - Intronic
1099673137 12:85719964-85719986 GTGTTCCAACAAAGAGAAGATGG + Intergenic
1100431356 12:94534292-94534314 GGGTCCTAACAAAGGGAAGAGGG + Intergenic
1101997651 12:109536369-109536391 GACTGTCAGCACAGGGAAGATGG + Exonic
1102152467 12:110698322-110698344 GAGACTTAACATTGGGAAGATGG + Intronic
1105033083 12:132898383-132898405 GAGGGTCAGCAAAGGGGAGATGG - Intronic
1107460899 13:40601110-40601132 TAGTCTGATGAAAGGGAAGATGG - Intronic
1107734195 13:43378944-43378966 GAGTCCTAAAAAGGGGAAGAGGG + Intronic
1109683450 13:65783665-65783687 GGGTCTCAACAAGGGGAACATGG + Intergenic
1111830248 13:93320078-93320100 GAGTCTAAGCAAAGGGGAAAAGG + Intronic
1114439647 14:22735955-22735977 GGGTCTCAAGAGAGGGAAAATGG - Intergenic
1115857051 14:37641560-37641582 TAGTCTCACCACAGTGAAGAGGG + Intronic
1116455954 14:45121148-45121170 CATTCTTAACAAAGGGTAGAGGG + Intronic
1116690945 14:48104761-48104783 GAGTCCCTTCAAAGGGAGGATGG - Intergenic
1119471054 14:74899484-74899506 AACTCTCAACAAGAGGAAGAGGG - Intronic
1120625743 14:86823839-86823861 GAGTTTTAACTAAGGCAAGAAGG + Intergenic
1121468708 14:94134984-94135006 GAGTTTCAACAAAGGTACTAAGG + Intergenic
1122966118 14:105127018-105127040 GAGTGTCAACAAATGGAAAGAGG - Intergenic
1125637718 15:41203413-41203435 GAGTCTCAACAAAGGGAAGAGGG - Intronic
1126216885 15:46165706-46165728 GAGGATGGACAAAGGGAAGATGG + Intergenic
1126666877 15:51083558-51083580 GAGTTTCAAGAAAGCCAAGATGG + Intronic
1127671452 15:61198929-61198951 GAGCCTCAGCAAAGGCAGGAAGG - Intronic
1129552805 15:76471995-76472017 GAGCCTGAACAATGTGAAGAAGG + Intronic
1130110675 15:80961205-80961227 GAGTCTCAGCAAAAAGCAGATGG - Intronic
1131270571 15:90945185-90945207 GAGGCTGAACAAAGGGAAAGTGG + Intronic
1131611712 15:93971249-93971271 GGGTTTGAAAAAAGGGAAGAAGG + Intergenic
1133180023 16:4047257-4047279 GAGTCTCAAAAAAAGGAGAAGGG - Intronic
1133536315 16:6705546-6705568 CATTCTCCAAAAAGGGAAGAAGG + Intronic
1134090852 16:11390986-11391008 GAGTGTCAGCACAGGGAAGGGGG - Intronic
1135601469 16:23787422-23787444 GGATCTCAACAAAGGGCTGAAGG + Intergenic
1136255204 16:29034379-29034401 GAGATTCAACATATGGAAGAGGG + Intergenic
1138036439 16:53611695-53611717 AAGTCTCAACAGAAAGAAGACGG + Intronic
1141155545 16:81594120-81594142 TTGTCTCAAAAAAGGGAGGAGGG - Intronic
1143447528 17:7018212-7018234 GAGTTCCTACAGAGGGAAGATGG - Intergenic
1143455481 17:7065006-7065028 GATTCTAAACCAGGGGAAGATGG + Intergenic
1144764751 17:17726242-17726264 GAGTCTGGGCAAAGGGTAGAAGG - Intronic
1146397482 17:32480316-32480338 CATTCTCATCACAGGGAAGAGGG - Intronic
1147320619 17:39643654-39643676 GAGACTCCACAGAGGGTAGAAGG - Intronic
1149242781 17:54669780-54669802 TAGTCTCACTAAAGGCAAGAAGG + Intergenic
1149379403 17:56078271-56078293 GGGCTTCAAGAAAGGGAAGAAGG - Intergenic
1150118603 17:62578895-62578917 GAGCCTTAAGAAAGGGAAGATGG + Intronic
1151189211 17:72385917-72385939 TAGTCTCTACAAAGGGAACATGG - Intergenic
1155111407 18:22718509-22718531 GGGGCACAACAAAGGGAAGAAGG - Intergenic
1157514801 18:48303317-48303339 GAGTCTCATCAGAGGGAGGTTGG - Intronic
1159593823 18:70363276-70363298 CTGTCTCAAAAAAGAGAAGAAGG + Intergenic
1161014652 19:1977787-1977809 GAGTCTCATGAAAGCGCAGAAGG - Intronic
1163427259 19:17246219-17246241 GAGGCTCAAGGAAGGGCAGAGGG - Intronic
1164186870 19:22878211-22878233 GATTCACAAAAAAGGGAATATGG - Intergenic
1166318373 19:42001635-42001657 AAGGCTCAACAAAGGGTGGAGGG - Intronic
1167954424 19:53052981-53053003 CAGTCTCAAAAAAAGAAAGAAGG - Intergenic
1168025931 19:53643583-53643605 GAGCCCCAACAAGGGGGAGAGGG - Intergenic
1168058989 19:53880021-53880043 GAGACACAGAAAAGGGAAGAGGG + Intronic
926103521 2:10136221-10136243 GAATCTCAATAAAGGGCAGAGGG + Intergenic
926190933 2:10727072-10727094 CTGTCTCAAAAAAGGGAGGAAGG - Intronic
926512135 2:13795006-13795028 AAGTCTCAACATAGTGAAGATGG - Intergenic
927269900 2:21195433-21195455 AAATCTGAAGAAAGGGAAGAAGG - Intergenic
928015559 2:27653675-27653697 GAGCCTCAAGAAAGTGAAGAAGG - Exonic
928664772 2:33539392-33539414 GAGAGACAACAAAGGGAAAAGGG - Intronic
928922631 2:36541442-36541464 GAGGCTCAGGAAAGGTAAGAGGG + Intronic
931268861 2:60684308-60684330 GAGACTCAAGAAAGGAAGGAAGG + Intergenic
931412719 2:62048904-62048926 GAGGCACAGTAAAGGGAAGAAGG - Intronic
931893211 2:66698698-66698720 CAGTCTGACCAAAGAGAAGAAGG - Intergenic
932659523 2:73640308-73640330 GGGTCTCTGCAGAGGGAAGAAGG - Intergenic
932666087 2:73699979-73700001 GGGTCTCTGCAGAGGGAAGAAGG - Intergenic
933192321 2:79348758-79348780 GTGTCTAGACAAGGGGAAGATGG - Intronic
938816839 2:134913201-134913223 TACAATCAACAAAGGGAAGAGGG - Intergenic
939175630 2:138744641-138744663 GAGGCTCAAGAAAAGGAAGAAGG - Intronic
939399504 2:141672364-141672386 GAGTGTTCACAAAGGGAAGAAGG + Intronic
941357217 2:164509217-164509239 GTAGCTCAACAAAGGGGAGAAGG + Intronic
941641664 2:167995601-167995623 GAGTATCAAGAGAGAGAAGATGG + Intronic
943311922 2:186335898-186335920 GACTCTCAAAACAGTGAAGAAGG + Intergenic
943786542 2:191883793-191883815 GGATCTCAACAAAAGCAAGAAGG - Intergenic
944068776 2:195647046-195647068 GAGACTCTAAAAATGGAAGAGGG - Intronic
944517623 2:200527994-200528016 GAGTTGATACAAAGGGAAGAAGG + Intronic
945946801 2:216002680-216002702 AGGTCTCAATAGAGGGAAGAAGG - Intronic
946968116 2:225060933-225060955 GAGACTTAACAAAGGCAAAATGG + Intergenic
947038248 2:225885087-225885109 GAAACCCAACATAGGGAAGAGGG - Intergenic
947090017 2:226499117-226499139 TAGTAGCAAGAAAGGGAAGATGG + Intergenic
947105952 2:226668053-226668075 GAGTCTCAACAGTGGGGAGGGGG - Intergenic
947121079 2:226815784-226815806 GTTCCTCAACAAATGGAAGATGG + Intergenic
948754774 2:240152760-240152782 GAGTCTTAAGAAAGGGAACATGG - Intergenic
948882502 2:240867365-240867387 GGGTCTCAAGAAAGGGGAAACGG - Intergenic
1169079972 20:2792032-2792054 CAGTGTCAACAAAGGCAAGAGGG - Intergenic
1171943967 20:31359286-31359308 AAGGCAGAACAAAGGGAAGAAGG + Intergenic
1172237390 20:33387483-33387505 GATTCTCAACAGAGAGAAAATGG - Exonic
1172608098 20:36229176-36229198 GAGTCACAATAAAGGGCATATGG + Intronic
1173297372 20:41771708-41771730 GAGGCTGAAGAAAGGGAAGCAGG + Intergenic
1173503209 20:43568112-43568134 TGGTCACAACAAAGGGTAGAGGG + Intronic
1174360263 20:50024420-50024442 GAGTCTGAACAAAGCAAAGGAGG - Intergenic
1174443502 20:50575010-50575032 GAGTCTGAAGAGAGGGAAGAAGG + Intronic
1177083512 21:16672913-16672935 GAGTCACAGCAAAGAGTAGAAGG - Intergenic
1177887262 21:26761861-26761883 GAGTTGCAGGAAAGGGAAGAGGG + Intergenic
1178676378 21:34634902-34634924 GAGACTCAAGAAAGGAAGGAAGG + Intergenic
1179011873 21:37562732-37562754 GAGATGCAAAAAAGGGAAGAAGG - Intergenic
1180131082 21:45827557-45827579 AAGTCTCAGCCAAGCGAAGACGG + Intronic
1180261127 21:46669612-46669634 GATTCTGAAGAAAGGGAAGAAGG - Intergenic
1181161774 22:20964037-20964059 GAGTCCCATCACAGGGCAGATGG - Intergenic
1182171791 22:28237712-28237734 GATTCTATACAAAGGAAAGAAGG - Intronic
1182462462 22:30492194-30492216 GAGACTCAACAGAGGGCAGAGGG + Intronic
1182467430 22:30525971-30525993 GAGACTCAACAGAGGGCAGAGGG + Intronic
1182607646 22:31519015-31519037 GCAAATCAACAAAGGGAAGAGGG - Intronic
1182977993 22:34641277-34641299 GAGTCTTATCAAAGGAAAAACGG + Intergenic
949207263 3:1455079-1455101 GAGTGTCAATAAAGGGCAAATGG - Intergenic
951219816 3:20057201-20057223 CAGTGCCAACAAAGGGAATAGGG + Intronic
954862354 3:53701542-53701564 GACTCGGAACAAAGGCAAGAAGG + Intronic
955157235 3:56428514-56428536 CAGTCTCAAAAAAAGAAAGAAGG + Intronic
956357922 3:68414341-68414363 GAGTCACAACTAGGGGAGGAGGG + Intronic
957062942 3:75496886-75496908 GAGTCTCCATAGAGGGGAGAGGG + Intergenic
957927371 3:86832014-86832036 GATACTAAACAAAGGGAAGGGGG + Intergenic
962073747 3:132058523-132058545 GACTCTCAACCAAGGGTAAATGG + Intronic
962778618 3:138689111-138689133 GACTCTCAAAAAAGGAAGGAAGG - Intronic
965124207 3:164603977-164603999 AAGTCTTAACAAATGTAAGAAGG - Intergenic
966450004 3:180048308-180048330 GAGTCTCAAAAAGAGGAAGAAGG - Intergenic
971170175 4:24225692-24225714 GGGTCTGAACAAATGGAAAATGG + Intergenic
971745879 4:30579807-30579829 AAGTCTAAACAAAGGGAGAAAGG + Intergenic
972003883 4:34073742-34073764 GAATATCAACAAAAGGAATAAGG + Intergenic
972561396 4:40232030-40232052 AAGTGCCAACAAAGGGAAAAAGG - Intronic
972727610 4:41759140-41759162 AATTCTGAACAAAGGGGAGAGGG + Intergenic
974522298 4:62997900-62997922 AAGTCTCAACAAATTTAAGAAGG + Intergenic
975280663 4:72558451-72558473 GAGTCTTTATAAATGGAAGAGGG - Intronic
977014873 4:91679449-91679471 GAGTCTCCTCAAAGGTTAGAGGG + Intergenic
979518928 4:121643648-121643670 CAGTGTAAATAAAGGGAAGAGGG - Intergenic
981794702 4:148583355-148583377 GACTCACAATAAAGGGATGAAGG - Intergenic
982987489 4:162229778-162229800 CAGTCTCAAGAATTGGAAGAAGG - Intergenic
983219393 4:165030383-165030405 GAGTCTGACCAATGGGATGAAGG - Intergenic
983442437 4:167803564-167803586 GAATCTCAAAAAAGGAAAGCTGG + Intergenic
984346627 4:178536590-178536612 GAATTTCAACAAAGGGATGAAGG + Intergenic
987053104 5:14165011-14165033 GTCTCTCAACAAAGGAAGGAAGG + Intronic
987761758 5:22172654-22172676 TAGTCTCTAAACAGGGAAGAGGG + Intronic
989199199 5:38746768-38746790 GATGGTCAGCAAAGGGAAGAAGG + Intergenic
989219597 5:38942102-38942124 AAGGCTCAACAAAGGAGAGAAGG + Exonic
989441178 5:41474065-41474087 GAGACTGAACAAAGGGATGAAGG + Intronic
989563552 5:42877727-42877749 GATTCTAGACAAAGGGAAGAAGG - Intronic
990171640 5:53057705-53057727 GACACTCAACAAAGGGTATAAGG - Intronic
991896542 5:71406093-71406115 TAGTCTCTAAACAGGGAAGAGGG + Intergenic
993335032 5:86646469-86646491 AAGTATCAACAAAATGAAGAGGG + Intergenic
993926289 5:93870202-93870224 TAGTTTCACCAAAGGGAGGAGGG + Intronic
994331699 5:98513778-98513800 GAGTAGCAGCAAAGGGAAAATGG - Intergenic
995797443 5:115956837-115956859 GAGAATCAACCAAGGGGAGATGG + Intergenic
996305389 5:122040497-122040519 GAGGGTCAATAAAGGGAGGAGGG + Intronic
997850656 5:137329857-137329879 GAGACTGAACAAATGGTAGAAGG + Intronic
998958278 5:147459076-147459098 GAGTCGCATCAATGGGAAAAGGG + Intronic
999383040 5:151135063-151135085 GAGGATGCACAAAGGGAAGAGGG + Intronic
1001449738 5:171815484-171815506 GTGTCTCAACAACGTCAAGAAGG + Intergenic
1003231391 6:4256832-4256854 GAGTTTGAACAGAGGAAAGACGG + Intergenic
1003877823 6:10453809-10453831 GAGTCACCACAAAGGGATGTTGG - Intergenic
1004442884 6:15670706-15670728 GAATCTCAACAAGGGAAGGAGGG + Intergenic
1004670317 6:17790044-17790066 GAATCTCAAAAAAGGTAAAATGG + Intronic
1005082241 6:21967925-21967947 GAGTCCTACCAAAGGGAAAAGGG - Intergenic
1006881310 6:37342324-37342346 GAGTTTCAATAAAGGTGAGATGG - Intergenic
1008138971 6:47810018-47810040 AATACTCAACAATGGGAAGAGGG + Intronic
1008274725 6:49529416-49529438 GTGTCTCAACAAAAAGAAGTAGG + Intergenic
1008898188 6:56581525-56581547 GTGGCTCAACAATGGGAAGGAGG + Intronic
1008918628 6:56818355-56818377 GAGGCTCAGCAAAGGAAACATGG + Intronic
1009667975 6:66707322-66707344 GGTTCTCAAGAAAGGGAAAATGG - Intergenic
1010118828 6:72348735-72348757 GAGGTTCCACAAAGGGGAGAGGG - Intronic
1010786787 6:80012304-80012326 GAGTCTCCATAACGGGTAGAAGG + Intronic
1011475657 6:87748586-87748608 GAGTCTCAAAAAAAGCAAAAAGG + Intergenic
1014558856 6:122865937-122865959 GAGAATCAACAAGGGGAACAAGG + Intergenic
1014900859 6:126963511-126963533 GAGGCACAACAAAGGACAGAAGG - Intergenic
1015293864 6:131568575-131568597 GAGTCTAAAAATAGGGAAGAAGG - Intergenic
1015639940 6:135320897-135320919 GAGACCCAACAATGAGAAGAAGG + Intronic
1016597283 6:145815667-145815689 GAATTACAACAAAGGAAAGATGG + Intergenic
1018969466 6:168516496-168516518 GAGTCTCAGTGAAGGGAACATGG + Intronic
1019668770 7:2266985-2267007 GAGTCACAGAAAAGGGCAGAGGG + Intronic
1020461900 7:8436113-8436135 GAGTTTAAACGAAGGGAAGTGGG + Intronic
1020960047 7:14790905-14790927 GAGTCTAAACATAGCAAAGATGG - Intronic
1021428309 7:20529361-20529383 GCGTCTAGACAAAGGGAACATGG - Intergenic
1021794224 7:24237272-24237294 CGGTCTCAAGAAAGGGAAAATGG - Intergenic
1021958369 7:25849496-25849518 CAGTCTGAAGAAAGGCAAGACGG - Intergenic
1023002732 7:35828376-35828398 CAGTCTCAAAAAAAAGAAGAAGG - Intronic
1023308985 7:38863599-38863621 GAGTCACAAAAAGGGAAAGAAGG + Intronic
1023881407 7:44323575-44323597 GGCTCGCAGCAAAGGGAAGAAGG + Intronic
1024586179 7:50843997-50844019 GAATTTCAACAAAGGGACGTAGG + Intergenic
1027724790 7:81790285-81790307 GAGTTTCAAAGAAGGGCAGAGGG + Intergenic
1027802587 7:82774133-82774155 GAGCTCCTACAAAGGGAAGAAGG - Intronic
1030282442 7:107790933-107790955 GAGACAAACCAAAGGGAAGATGG + Intronic
1030360079 7:108586589-108586611 GAGACTCAAAAAGGAGAAGAGGG - Intergenic
1031846236 7:126808546-126808568 GAGGCTGAACAAAGGTAACAGGG - Intronic
1032084623 7:128877430-128877452 GAGGCTCAGCACAGAGAAGAAGG - Intronic
1033543003 7:142374358-142374380 GAGTCCCATTGAAGGGAAGATGG - Intergenic
1034287639 7:149899025-149899047 GAGTGTCAACAAAGGCCAAAAGG + Intergenic
1034663489 7:152793897-152793919 GAGTGTCAACAAAGGCCAAAAGG - Intronic
1038219751 8:25596025-25596047 CTGTCTCAAAAAAGGGAAAAAGG - Intergenic
1039061946 8:33578942-33578964 GTGTTTCAATAAAAGGAAGAAGG + Intergenic
1040596850 8:48846869-48846891 GACCCTCAACAAGGGGAAAAAGG + Intergenic
1041037500 8:53809452-53809474 GAGAGTCACTAAAGGGAAGAAGG + Intronic
1041827505 8:62112915-62112937 GAATTTCAACAAAGGGACCAAGG - Intergenic
1042335738 8:67628532-67628554 CAGTGGCTACAAAGGGAAGATGG - Intronic
1045144335 8:99323325-99323347 CTGTCTCAACAAAGGATAGAGGG + Intronic
1045271670 8:100667362-100667384 GGGGCTCCACAAAGGGAAAATGG + Intergenic
1045634119 8:104163176-104163198 GAGCTGCATCAAAGGGAAGATGG - Intronic
1048588891 8:135802822-135802844 GAGCCTCCACAAAGGGAGGGAGG - Intergenic
1049070804 8:140354190-140354212 GAGTCTCTTAAAAGGGCAGAGGG - Intronic
1049466356 8:142752779-142752801 GGGTCCCCACAAAGGGAAGAAGG - Intergenic
1052609768 9:30758109-30758131 GTGTCTCAACAAGGGGAATATGG + Intergenic
1052680393 9:31684267-31684289 GACTGTTAACAAAGGGGAGATGG + Intergenic
1056617029 9:88177601-88177623 TAGTCTCAATAGAGGGAAGAAGG + Intergenic
1057804627 9:98211424-98211446 GTGTCCCAAGCAAGGGAAGAGGG - Intronic
1060841078 9:126793606-126793628 GAGTCTCAATACAGGGCATAAGG - Intergenic
1061352101 9:130073631-130073653 GGGGCCCAAAAAAGGGAAGAAGG + Intronic
1186020867 X:5253674-5253696 TTGTCTCAACTAAAGGAAGAGGG - Intergenic
1186532446 X:10310963-10310985 GAGTAGCAAGAAAGGAAAGAGGG + Intergenic
1186570592 X:10711133-10711155 GAGTCTGAAGTAAGGGAGGAAGG - Intronic
1186573837 X:10744453-10744475 GAGCCTCAACAAAAGGAGAAAGG + Intronic
1186748128 X:12591810-12591832 GAGCCTCAACAAGTGCAAGAAGG - Intronic
1188236577 X:27739124-27739146 GAGTGACAACAAAGGGAAATGGG - Intronic
1189139323 X:38584814-38584836 GTTTCTCAGGAAAGGGAAGAGGG - Intronic
1192490746 X:71575103-71575125 GGATCTCAACAAAGGGTCGAGGG + Exonic
1193499926 X:82262936-82262958 GGGTCTCAAGAAAGGGAAAATGG + Intergenic
1197141311 X:123120963-123120985 GAGACTCAAAAAGGGGAGGATGG + Intergenic
1197755358 X:129990084-129990106 GAGGCTCAACAAAGTTAAGTGGG - Intronic
1199353420 X:146831991-146832013 GTGTCTCAACAAAGGGAACATGG - Intergenic